ID: 1051215807

View in Genome Browser
Species Human (GRCh38)
Location 9:14796127-14796149
Sequence TTCCCTATGAGCCACTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051215807_1051215812 1 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215812 9:14796151-14796173 AGCAGGATATGGGGCAGATAAGG No data
1051215807_1051215809 -10 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215809 9:14796140-14796162 TCATAGGGAACAGCAGGATATGG No data
1051215807_1051215810 -9 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG No data
1051215807_1051215813 5 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215813 9:14796155-14796177 GGATATGGGGCAGATAAGGAAGG No data
1051215807_1051215814 6 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215814 9:14796156-14796178 GATATGGGGCAGATAAGGAAGGG No data
1051215807_1051215815 18 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215815 9:14796168-14796190 ATAAGGAAGGGACTTGTTTGAGG No data
1051215807_1051215811 -8 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA No data
Right 1051215811 9:14796142-14796164 ATAGGGAACAGCAGGATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051215807 Original CRISPR TTCCCTATGAGCCACTGATA AGG (reversed) Intronic