ID: 1051215810

View in Genome Browser
Species Human (GRCh38)
Location 9:14796141-14796163
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051215803_1051215810 10 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT 0: 1
1: 0
2: 0
3: 38
4: 368
Right 1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG No data
1051215807_1051215810 -9 Left 1051215807 9:14796127-14796149 CCTTATCAGTGGCTCATAGGGAA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG No data
1051215802_1051215810 11 Left 1051215802 9:14796107-14796129 CCCATAATGCTTTTTAAGAACCT 0: 1
1: 0
2: 2
3: 24
4: 312
Right 1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr