ID: 1051217874

View in Genome Browser
Species Human (GRCh38)
Location 9:14817976-14817998
Sequence GTTTGACTCCAGTCATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051217874_1051217879 28 Left 1051217874 9:14817976-14817998 CCAAAGGATGACTGGAGTCAAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG No data
1051217874_1051217880 29 Left 1051217874 9:14817976-14817998 CCAAAGGATGACTGGAGTCAAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1051217880 9:14818028-14818050 TATACTAGCTGAATGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051217874 Original CRISPR GTTTGACTCCAGTCATCCTT TGG (reversed) Intronic
900685542 1:3945652-3945674 TTTTGAATCCAGTGATCCCTAGG + Intergenic
906056463 1:42921969-42921991 GTTTTGCTCCTGTCATCCCTTGG - Intergenic
907837579 1:58125881-58125903 GTATCACTCCACTCATGCTTTGG + Intronic
911187294 1:94916484-94916506 GCCTGTCTCCAGTCATCCTCTGG + Intronic
912059586 1:105650058-105650080 TTTTGCCACCAGTCATCTTTAGG + Intergenic
912944984 1:114077452-114077474 ATTTGAGTCCAGCCATCATTGGG - Intergenic
913315450 1:117547142-117547164 ATTTCTCTCCAGTCAACCTTTGG + Intergenic
919043657 1:192424499-192424521 TTTTGACTCCATTCATTCTGGGG - Intergenic
920670025 1:207996667-207996689 TTTTAACTCCATTCATCCTCTGG + Intergenic
921395409 1:214663745-214663767 GTTGGACTCCAGTCCAGCTTTGG - Exonic
924495012 1:244579131-244579153 GTGTGACACTAGTCATCCTGTGG - Intronic
1066194418 10:33084853-33084875 GCTTGGCTGCAGTCATCTTTGGG - Intergenic
1070112497 10:73498750-73498772 CTTTGCCTCCAGTCATCATCTGG + Exonic
1070664521 10:78333754-78333776 GGGTAACTCCCGTCATCCTTTGG - Intergenic
1073980499 10:109148249-109148271 GTTGCACTCCAGACATCCGTGGG - Intergenic
1077820435 11:5732897-5732919 GTTCTTCTCCAGTCATCCTTAGG + Intronic
1086269135 11:85039145-85039167 CTTTGCCTCCAGTCAGCTTTTGG + Intronic
1089320606 11:117624317-117624339 GAATGACTCCAGTCATTCTTAGG - Intronic
1089513029 11:119012633-119012655 GTCTGCCTCCATTCAGCCTTTGG + Intronic
1091540165 12:1453265-1453287 GTTTGAATCCATTCATAATTTGG + Intronic
1094561945 12:31563197-31563219 GTTTAAGTCCAGTCTTCCTTTGG - Intronic
1095686858 12:45046338-45046360 CCATCACTCCAGTCATCCTTTGG - Intronic
1096266272 12:50125202-50125224 GTTTGACTGAAATCATCTTTTGG + Intergenic
1098257402 12:68630889-68630911 GGTTGACACCTGTAATCCTTGGG - Intronic
1099995263 12:89771343-89771365 ACTTGACTCCTGCCATCCTTGGG + Intergenic
1101134828 12:101732422-101732444 TTCTGACTACAGACATCCTTAGG + Intronic
1101241556 12:102844346-102844368 GCTGGGCTCCTGTCATCCTTTGG - Exonic
1101309741 12:103565242-103565264 GGGTGCCTCCACTCATCCTTGGG + Intergenic
1101509383 12:105379322-105379344 CTCTGACTCCAGCCATCTTTTGG + Intronic
1105737696 13:23288151-23288173 GATTGACTCCAGGTAGCCTTTGG + Intronic
1107563383 13:41577494-41577516 GCTTGACTAAAGTCATCCATGGG + Intronic
1109788828 13:67220618-67220640 GTTTCAGACCAGTCATCCTATGG - Intronic
1110243291 13:73292700-73292722 CTTTGTCTTCAGTCATCCCTTGG + Intergenic
1110332239 13:74286074-74286096 GTTTATCTTCAGTTATCCTTTGG - Intergenic
1110437936 13:75495952-75495974 GTAGCACTCCAGTCATCTTTGGG + Intergenic
1111069648 13:83148282-83148304 GTTTGACTTCACTAATCATTAGG - Intergenic
1118784897 14:69037770-69037792 GTTAGACACCAGGAATCCTTGGG + Intergenic
1131664399 15:94555140-94555162 ATTTGCCTCTCGTCATCCTTGGG - Intergenic
1132366960 15:101264778-101264800 GTTGGACTCCAGCAAGCCTTAGG - Intergenic
1138088508 16:54155321-54155343 GTTAGAATCCAGTCATCGATCGG - Intergenic
1140682622 16:77400320-77400342 CTTAGCCTCCAGCCATCCTTTGG + Intronic
1146207883 17:30920558-30920580 GTGTGATTCCCGTCATCCCTGGG - Intronic
1159350547 18:67267185-67267207 GTTTTCCTGCAGTCTTCCTTTGG + Intergenic
1160073591 18:75650431-75650453 GTTTTGGTCCAGTCATCATTGGG + Intergenic
1163639503 19:18453554-18453576 TTTTTATTCCAGTCATCCCTGGG - Intronic
1168461044 19:56558716-56558738 GTTTGAATTAAGTCATCCTTTGG + Intergenic
1168488280 19:56784074-56784096 GTCTGTTTCCAGTCATACTTTGG + Intronic
925853816 2:8110252-8110274 GCTCAACTCCAGTCATCCCTGGG + Intergenic
928710778 2:34002912-34002934 TTCTCTCTCCAGTCATCCTTTGG + Intergenic
933645933 2:84812731-84812753 CTTTAATTCCAGGCATCCTTGGG + Intronic
938208636 2:129445122-129445144 GTTAGCCTCCAATCATCCTAAGG - Intergenic
945588125 2:211692814-211692836 ATTTGAATGCAGTCATCCTCAGG + Intronic
947147524 2:227081846-227081868 GTTTGGCTCAAGCCCTCCTTTGG - Intronic
948069942 2:235112624-235112646 TTTTGCCTCCAGACAACCTTTGG + Intergenic
1173113331 20:40216857-40216879 GGTTGTCTCCTGTCACCCTTTGG + Intergenic
1179175648 21:39005998-39006020 GTTTGACTCCATCCATACTTGGG + Intergenic
1179433114 21:41338735-41338757 GTTTGACTGCAGTTGTACTTAGG + Intronic
951343289 3:21515545-21515567 GTTTCATTCCAGTCATGTTTTGG - Intronic
952564521 3:34639160-34639182 CTTTTACTCCAGACATCATTTGG + Intergenic
952580504 3:34827817-34827839 GTTCTACTCCTGTCCTCCTTTGG + Intergenic
954456104 3:50600676-50600698 CTTTGACTGCAGTCAACCATGGG + Intergenic
957118344 3:76056296-76056318 GTCTGAATACAGTCATCCCTTGG - Intronic
962548235 3:136459480-136459502 GTTTAACTCCAGTGTTTCTTTGG - Intronic
963711650 3:148754257-148754279 GTTTTTCTCCAGGCAACCTTTGG - Intergenic
964097439 3:152949008-152949030 CTTGGACTCAAGTCATCCTCTGG - Intergenic
965533874 3:169804139-169804161 TTTTGTTTCCAGTCATTCTTAGG + Exonic
965892961 3:173537860-173537882 GTTGCACTCCAGTTTTCCTTTGG + Intronic
971097134 4:23420055-23420077 TTTTGTCTCCTGTCATCCTTGGG + Intergenic
975370284 4:73578212-73578234 GTTTCCTTCCAGTCATTCTTGGG - Intronic
978161877 4:105558313-105558335 GTTTTACTCCATTCTTCATTTGG - Intronic
978347389 4:107786375-107786397 CTTTGACTCCAGGCATCCTATGG - Intergenic
979518942 4:121643735-121643757 GTTTGACTCAATTCACCCTTAGG + Intergenic
983113853 4:163787474-163787496 GCTTGACACCACTAATCCTTCGG + Intronic
983155706 4:164345337-164345359 GCTGGACTCAAGTGATCCTTTGG - Intronic
983931235 4:173455219-173455241 GTTTGACTCCTGCCAGTCTTGGG - Intergenic
984646199 4:182222923-182222945 CTCTGAATCCAGCCATCCTTTGG + Intronic
985141159 4:186841306-186841328 GTTTTGCTGCAGTCATTCTTTGG + Intergenic
989260898 5:39419105-39419127 GTTTGACATCAGGCATTCTTAGG + Intronic
991519188 5:67476453-67476475 CATTGACTCAAGTCATTCTTTGG + Intergenic
994766576 5:103925516-103925538 TCTTGATTCTAGTCATCCTTTGG + Intergenic
996909335 5:128637099-128637121 GTTCGAGCACAGTCATCCTTTGG - Intronic
1001891763 5:175345306-175345328 CTTTGACCCCAGTCACCCTGCGG - Intergenic
1004662436 6:17722107-17722129 GCCTCCCTCCAGTCATCCTTAGG - Intergenic
1005520244 6:26594913-26594935 GTTTGAATGTGGTCATCCTTAGG + Intergenic
1010222262 6:73458139-73458161 GTTTATCTCTAGTCAGCCTTGGG + Intergenic
1015334750 6:132024114-132024136 ATTTGACACAAGACATCCTTAGG - Intergenic
1017142301 6:151202399-151202421 TTGTTTCTCCAGTCATCCTTTGG - Intergenic
1017414311 6:154203664-154203686 GTTGCAATCCAGTCATCCCTTGG - Intronic
1017621628 6:156305095-156305117 TTTGGACTCCAGTCCTTCTTTGG - Intergenic
1018838561 6:167502979-167503001 GGTTGACGCCAGCCATCCTCTGG - Intergenic
1019901504 7:4024620-4024642 GTCTTACTCCATTCATCCCTGGG + Intronic
1023702340 7:42905053-42905075 GTTTGACTCCAGTGGTTCTGGGG - Intergenic
1025962922 7:66239661-66239683 GTTGGACTCCAGACATTCTTGGG + Intronic
1031544567 7:123035408-123035430 GATTGACCCCAGTCATCATGAGG + Intergenic
1031580200 7:123464931-123464953 GTTTGACTCCTCTCATCATAAGG + Exonic
1037363703 8:18100355-18100377 GCTTAACTCCTGTCCTCCTTAGG + Intergenic
1037636521 8:20705317-20705339 GTTTGTCTCCACTCCTCCCTAGG + Intergenic
1041137567 8:54776566-54776588 CTTTGACTATAGTCATCTTTTGG - Intergenic
1042267944 8:66927466-66927488 GTTTGCCTCCAGTTATCATATGG - Intergenic
1043700760 8:83285802-83285824 GTTTTACCTCAGTCATTCTTGGG + Intergenic
1044856048 8:96476968-96476990 TTTTGGCTCCATTCACCCTTTGG - Intergenic
1045504444 8:102768669-102768691 GGTTGGCTTCAGTCATCTTTAGG - Intergenic
1051217874 9:14817976-14817998 GTTTGACTCCAGTCATCCTTTGG - Intronic
1052620578 9:30903704-30903726 TTTTGCCTCCAGTCTGCCTTAGG - Intergenic
1055980960 9:81999972-81999994 GTTTGGCTGCAGTAAACCTTTGG + Intergenic
1057897868 9:98924289-98924311 GTTTGTCTCCCCTCCTCCTTGGG + Intergenic
1059067240 9:111098344-111098366 TCTTTACTCCAGTCATCTTTAGG - Intergenic
1060587742 9:124796967-124796989 CTTTGACTTCTGTCATCCCTGGG + Intronic
1186325703 X:8474592-8474614 GTTTAACTCCAATCTTGCTTTGG + Intergenic
1187077472 X:15949321-15949343 GTCTGACACCATTCCTCCTTTGG - Intergenic
1188184864 X:27101334-27101356 GAATCACTCCAGTCATTCTTGGG - Intergenic
1188779347 X:34261090-34261112 TCTTGGCTCCATTCATCCTTGGG - Intergenic
1191236506 X:58138631-58138653 GTTTGACCTCAGACATCCTAAGG + Intergenic
1193938758 X:87654527-87654549 ATTTTAATCCAGTCATCCATTGG + Intronic
1197888455 X:131242224-131242246 GTTGGACTTCCGTCATCCTTGGG + Intergenic
1197896879 X:131325465-131325487 ATTTGACTCCAGTCCTCCAGGGG + Intronic
1197963730 X:132033913-132033935 TTCTTACTCCAGTCTTCCTTGGG - Intergenic
1200791735 Y:7305262-7305284 GTCTCTCTCCAGTCATCCTCAGG + Intergenic
1200814857 Y:7521208-7521230 TTTTGATTCAAGTAATCCTTTGG - Intergenic