ID: 1051217879

View in Genome Browser
Species Human (GRCh38)
Location 9:14818027-14818049
Sequence ATATACTAGCTGAATGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051217874_1051217879 28 Left 1051217874 9:14817976-14817998 CCAAAGGATGACTGGAGTCAAAC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051217879 Original CRISPR ATATACTAGCTGAATGAACT TGG Intronic
No off target data available for this crispr