ID: 1051219472

View in Genome Browser
Species Human (GRCh38)
Location 9:14832964-14832986
Sequence TTTGTTACTGACCGTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051219472_1051219478 15 Left 1051219472 9:14832964-14832986 CCAGCAGAACGGTCAGTAACAAA 0: 1
1: 0
2: 5
3: 48
4: 433
Right 1051219478 9:14833002-14833024 CCAACTTGTTTCATGTCCTTAGG No data
1051219472_1051219479 26 Left 1051219472 9:14832964-14832986 CCAGCAGAACGGTCAGTAACAAA 0: 1
1: 0
2: 5
3: 48
4: 433
Right 1051219479 9:14833013-14833035 CATGTCCTTAGGAACATAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051219472 Original CRISPR TTTGTTACTGACCGTTCTGC TGG (reversed) Intronic
901908912 1:12438413-12438435 TTTGTTTCTCACAGTTCTGGAGG - Intronic
902735381 1:18397365-18397387 TTTATTGCTCACCGTTCTGGAGG - Intergenic
902947137 1:19849761-19849783 TTTGTTACTGACCAACTTGCTGG + Intergenic
903558894 1:24212951-24212973 TTTGTTCTTGACAGTTCTGGAGG - Intergenic
904636958 1:31889546-31889568 TTTGTTACTCATAGTTCTGGAGG + Intergenic
904709257 1:32416208-32416230 TTTATTACTGACCATTCTGTTGG - Intergenic
904969543 1:34408397-34408419 TTTGTTACTGCCCATTTTACAGG + Intergenic
907269624 1:53283305-53283327 TTTGTTGCTCACAGTTCTGGAGG - Intronic
907531917 1:55107878-55107900 TTTGTTAATGACAGTTTTGTGGG - Intronic
908056999 1:60298575-60298597 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
909061705 1:70886320-70886342 TTTGTTTCTCACAGTTCTGGAGG - Intronic
909242646 1:73234853-73234875 TTTGTTAATGACCATTCTAATGG + Intergenic
909408261 1:75317655-75317677 TTTGTTTCTGACAGTTCTGGGGG + Intronic
909523639 1:76598006-76598028 TTTATTACTCACAGTTCTGCAGG + Intronic
909757569 1:79245534-79245556 TTTATTTCTGACAGTTCTGGAGG + Intergenic
909832046 1:80203891-80203913 TTTGTTGCTCACAGTTCTGATGG + Intergenic
909943342 1:81635498-81635520 TTTGTTTCTCACAGTTCTGAAGG + Intronic
911408244 1:97468552-97468574 TTTGTTTCTCACAGTTCTGGAGG - Intronic
911614249 1:99990992-99991014 TTTATTTCTCACAGTTCTGCAGG - Intronic
911659600 1:100486487-100486509 TTTATTTCTCACGGTTCTGCAGG + Intronic
912453034 1:109779031-109779053 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
913240032 1:116821980-116822002 TTTATTACTCACAGTTCTGGAGG + Intergenic
913348205 1:117829037-117829059 TTTGTTTCTTACAGTTCTGAAGG + Intergenic
915777299 1:158503711-158503733 TTTATTTCTCACAGTTCTGCAGG - Intergenic
916201006 1:162271762-162271784 TTTGTTTCTCACAGTTCTGGAGG + Intronic
916992829 1:170263324-170263346 TTTATTACTTACAGTTCTGGAGG + Intergenic
917029295 1:170671589-170671611 TTTGTTACTGTCTGTCCTGCAGG - Intronic
917201622 1:172522910-172522932 TTTATTTCTGACAGTTCTGGAGG - Intergenic
917241745 1:172956175-172956197 TTTATTTCTCACAGTTCTGCAGG - Intergenic
917293631 1:173495748-173495770 TTTGCTACTGACCAGCCTGCTGG - Intergenic
917814922 1:178698711-178698733 TTTATTCCTCACAGTTCTGCAGG + Intergenic
919026118 1:192172474-192172496 TATTTTACTCACAGTTCTGCCGG - Intronic
919331548 1:196178441-196178463 TTTGTGTCTTACAGTTCTGCGGG - Intergenic
920530336 1:206697396-206697418 TTTATTGCTCACAGTTCTGCAGG + Intronic
920640140 1:207743865-207743887 TTTGTTACTGACAGTTTTGTTGG - Intergenic
920648039 1:207817606-207817628 TCTGTTACTGGCCTTTCTCCAGG - Intergenic
921077094 1:211708514-211708536 TTTGTTACTGACCAGCTTGCAGG - Intergenic
921172998 1:212565729-212565751 TTTTTTACTGACCCCTCTGCAGG + Intronic
922360339 1:224815884-224815906 TTTATTACTCACAGTTCTGGAGG + Intergenic
923378127 1:233387140-233387162 TTTGTTGCTCACAGTTCTGGAGG - Intergenic
923381435 1:233423450-233423472 TATGGTGCTCACCGTTCTGCAGG + Intergenic
1062818751 10:518667-518689 TTTGTTTCTCACAGTTCTGGAGG - Intronic
1063319619 10:5040592-5040614 TTTGTTTCTGATGGTTCTTCAGG + Intronic
1063856953 10:10265545-10265567 TTTATTTCTGACTGTTCTGGGGG - Intergenic
1065774109 10:29103338-29103360 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1067171651 10:43911902-43911924 TTTGTTTCTCACAGTTCTGGGGG + Intergenic
1067823142 10:49548674-49548696 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1068004343 10:51374723-51374745 TTTATTTCTTACCGTTCTGGAGG - Intronic
1068241193 10:54302616-54302638 TTTATTTCTGACAGTTCTGGAGG - Intronic
1068480001 10:57578328-57578350 TTTGTTACTGACCATTTTGTTGG + Intergenic
1068496602 10:57791154-57791176 TTTGTTACTGGCCGTTTTGTTGG - Intergenic
1068789468 10:61011166-61011188 TTTGTTTCTCACTGTTCTGGAGG - Intergenic
1068790473 10:61025364-61025386 TTTATTTCTGACAGTTCTGGAGG + Intergenic
1069792849 10:71034265-71034287 TTTGTGCCTGACCCTTCTGGGGG - Intergenic
1071419533 10:85478066-85478088 TTTGTGACTCACAGTTCTGGAGG + Intergenic
1073006313 10:100327804-100327826 TTTGTCACTGGCCACTCTGCAGG - Intronic
1073859203 10:107717940-107717962 TTTATTCCTCACAGTTCTGCAGG - Intergenic
1074347245 10:112699291-112699313 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1074676631 10:115858930-115858952 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1075156831 10:119984781-119984803 TTTGTTGCTCACAGTTCTGGAGG + Intergenic
1075264906 10:120991774-120991796 TTCGTTACTGACCAGTTTGCGGG - Intergenic
1076104068 10:127806243-127806265 TTGGTTGCTGACACTTCTGCTGG + Intergenic
1077998943 11:7477282-7477304 TTTATTTCTGACTGTTCTGGAGG - Intergenic
1079345611 11:19649440-19649462 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1080029157 11:27642770-27642792 TTTATTTCTGACTGTTCTGGAGG - Intergenic
1080075008 11:28138805-28138827 TTTGTTACTGCCCAGTTTGCTGG + Intronic
1080143313 11:28948821-28948843 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1080563747 11:33489177-33489199 TTTATTACTCACAGTTCTGGAGG + Intergenic
1081464487 11:43303990-43304012 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1082121361 11:48383403-48383425 TTTGTTACTGACCATTTTGTTGG + Intergenic
1082228800 11:49740250-49740272 TTTGTTACTGATCATTTTGTTGG + Intergenic
1082252504 11:49997227-49997249 TTTGTTACTGACCATTTTGTTGG - Intergenic
1082555349 11:54557654-54557676 TTTGTTACTGACCATTTTGTTGG + Intergenic
1082866778 11:57907284-57907306 TTTGTTACTAACCAGTTTGCTGG + Intergenic
1084436437 11:69144289-69144311 TTTGTTACTCACAGATCTGCAGG + Intergenic
1085469712 11:76749787-76749809 TTTGTTACTGAGGGTTCACCAGG - Intergenic
1086300873 11:85424887-85424909 TTTATTTCTCACCATTCTGCAGG - Intronic
1086615903 11:88819756-88819778 TTTGTTTCTTACAGTTCTGGAGG + Intronic
1086621266 11:88888873-88888895 TTTGTTACTGATCATTTTGTTGG - Intronic
1086838899 11:91660325-91660347 TTTGTTTCTCAGCGTTCTGGAGG + Intergenic
1088104134 11:106186537-106186559 TTTGTTACTGGCCAGCCTGCTGG - Intergenic
1088747368 11:112815448-112815470 TTTATTTCTGACAGTTCTGGAGG + Intergenic
1088999595 11:115040619-115040641 TTTATTTCTCACCGTTCTGAAGG + Intergenic
1089731109 11:120519525-120519547 TTTGTTTCTCACAGTTCTGGAGG - Intronic
1089748289 11:120632296-120632318 TTTATTTCTCACCGTTCTGAAGG - Intronic
1090482647 11:127081738-127081760 TTTTTGTCTGACAGTTCTGCTGG - Intergenic
1092730108 12:11523244-11523266 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1093269288 12:17039036-17039058 TTTATTGCTGACAGTTCTGGAGG - Intergenic
1093275932 12:17126739-17126761 TTTGTTTCTTACAGTTCTGTAGG + Intergenic
1093769585 12:23003197-23003219 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1093823622 12:23653573-23653595 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1093920765 12:24856807-24856829 TTTGTAACTGACCAGTTTGCGGG - Intronic
1094741522 12:33294974-33294996 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG + Intergenic
1097717686 12:62983770-62983792 TTTATTTCTGACAGTTCTGGAGG + Intergenic
1097842110 12:64331768-64331790 TTTGTTTCTCACAGTTCTGGAGG - Intronic
1098160558 12:67645097-67645119 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1098233028 12:68392067-68392089 CTTATTACTGACAGTGCTGCAGG + Intergenic
1098884520 12:75946847-75946869 TTTCTTACCCACAGTTCTGCAGG + Intergenic
1099402040 12:82211953-82211975 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1099890398 12:88582591-88582613 TTTGTGTCTGCACGTTCTGCAGG - Intergenic
1100245494 12:92752804-92752826 TTTGTTGCTCACAGTTCTGGAGG + Intronic
1101188483 12:102306490-102306512 TTTGTTATTGACCAGCCTGCTGG - Intergenic
1101383567 12:104235763-104235785 TTTGTTACTGACCATTTTGTTGG - Intronic
1103067894 12:117915196-117915218 TTTATTTCTCACAGTTCTGCAGG + Intronic
1104211372 12:126691905-126691927 TGTGCTACTGACCTTTCTGGGGG - Intergenic
1104424702 12:128666405-128666427 TTTGTTTCTTACAGTTCTGGAGG - Intronic
1106049639 13:26178243-26178265 TTTGTTTCTCACAGTTCTGAAGG + Intronic
1106580749 13:31016463-31016485 TTTGTTTCTTACAGTTCTGGAGG + Intergenic
1107100872 13:36589761-36589783 TCTGTTTCTGACCTTTCTGATGG + Intergenic
1108258995 13:48638312-48638334 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1108856663 13:54800805-54800827 TTTATTACTTACAGTTCTGGTGG - Intergenic
1111002481 13:82204189-82204211 TTTATTTCTCACCGTTCTGGAGG - Intergenic
1111189727 13:84791426-84791448 TTTGTAACTGACCAACCTGCTGG - Intergenic
1111246177 13:85544651-85544673 TTTATTACTCACAGTTCTGGAGG - Intergenic
1111513691 13:89298879-89298901 TTTATTTCTCACTGTTCTGCAGG - Intergenic
1112140158 13:96632281-96632303 TTTATTTCTGACAGTTCTGGAGG - Intronic
1112396395 13:99036484-99036506 TTTGTTTCTCACAGTTCTGGAGG - Intronic
1112976315 13:105322927-105322949 TTTCTTCCTCACAGTTCTGCAGG + Intergenic
1113026505 13:105946619-105946641 TCTGTTTCTGACAGTTCTGGAGG + Intergenic
1113988285 13:114337061-114337083 TGTGTTACTGACTGTTCAGGTGG - Intergenic
1114171469 14:20277065-20277087 TTTATTTCTGACAGTTCTGCAGG + Intronic
1114334846 14:21677469-21677491 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1114562237 14:23601701-23601723 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
1114740884 14:25096140-25096162 TTAGTGACTGACTGCTCTGCTGG + Intergenic
1114836607 14:26210463-26210485 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1114896017 14:26992334-26992356 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1115389965 14:32843026-32843048 TATTTGACTCACCGTTCTGCTGG - Intergenic
1116142093 14:41010518-41010540 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1118530067 14:66694329-66694351 TTTATTTCTCACTGTTCTGCAGG - Intronic
1119697520 14:76725471-76725493 TTTGTTGCTTAAAGTTCTGCTGG + Intergenic
1120087642 14:80293220-80293242 TTTATTTCTCACAGTTCTGCAGG + Intronic
1121388968 14:93558082-93558104 TTTGTAGCTGACCAATCTGCAGG + Intronic
1121963817 14:98286086-98286108 TTTGTTACTCGCAGTTCTGGAGG + Intergenic
1122093291 14:99353861-99353883 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1123872542 15:24591740-24591762 TTTGTAACTGACCTGTCTGCAGG + Intergenic
1124362994 15:29052732-29052754 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1124719231 15:32097564-32097586 TTTGTTTCTCACAGTTCTGGCGG - Intronic
1126377898 15:48014604-48014626 TTTATTACTGACCATTCTGGAGG + Intergenic
1129497534 15:75999603-75999625 TTTATTTCTGACAGTTCTGAAGG - Intronic
1130036889 15:80369059-80369081 TTTGTTACTGACCATTTTGTTGG - Intronic
1130309231 15:82738502-82738524 TTTATTTCTCACCGTTCTGGAGG + Intergenic
1130446924 15:84011445-84011467 TTTGTTTCTTACAGTTCTGGAGG + Intronic
1130618978 15:85441207-85441229 TTTTTTAATGGCCGTTCTGGTGG + Intronic
1131560202 15:93433019-93433041 TTTATTTCTTACCGTTCTGGAGG + Intergenic
1131689836 15:94814815-94814837 TTTATTGCTGAGAGTTCTGCAGG - Intergenic
1131891429 15:96975862-96975884 TTTATTTCTCACCGTTCTGGAGG - Intergenic
1135144757 16:19951501-19951523 TTTGTAACTGACCAGTCTGCTGG - Intergenic
1135150289 16:19999425-19999447 TTTATTGCTCACAGTTCTGCAGG + Intergenic
1135309241 16:21392370-21392392 TTTGTTACTTACGGTAATGCTGG + Intergenic
1135835544 16:25822188-25822210 TTTATTTCTCACCGTTCTGGAGG + Intronic
1136148822 16:28332697-28332719 TTTGTTACTTACGGTAATGCTGG + Intergenic
1136305984 16:29371500-29371522 TTTGTTACTTACGGTAATGCTGG + Intergenic
1137906969 16:52333046-52333068 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1138493320 16:57390944-57390966 TTTGTTTCTTACAGTTCTGCAGG - Intergenic
1138692256 16:58779364-58779386 TTTGTTGCTCACAGTTCTGGAGG + Intergenic
1138825010 16:60308610-60308632 TTTGTTTCTCACAGTTCTGAAGG + Intergenic
1138830820 16:60372769-60372791 TTTGCTACTCACTGTTCTCCTGG + Intergenic
1138864233 16:60796729-60796751 TTTGTTACTGCCTGTACTGGTGG - Intergenic
1140706886 16:77639068-77639090 TTTGTTTCTCACAGTTCTGAAGG - Intergenic
1141224877 16:82105340-82105362 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
1141981651 16:87554023-87554045 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1142162072 16:88562863-88562885 TTTGTTTCTTACAGTTCTGAAGG + Intergenic
1142790783 17:2263947-2263969 TTTGTTTCTGACTGTTCTCTTGG - Intronic
1143231281 17:5357743-5357765 TGTGTTACTCACAGTTCTCCTGG + Intronic
1145855542 17:28153371-28153393 TTTACTTCTGACAGTTCTGCAGG + Intronic
1146432258 17:32808832-32808854 TTTATTTCTGACAGTTCTGGAGG - Intronic
1146645611 17:34575396-34575418 TTTTTTTCTCACCGTTCTGGAGG - Exonic
1148626679 17:49074758-49074780 TTTGTTACTGGCCAGTTTGCTGG + Intergenic
1150188656 17:63214511-63214533 TTTATTACTCACAGTTCTGGAGG + Intronic
1150308521 17:64107721-64107743 TTTGTTACTCACTGTTCAGGTGG - Intronic
1151077921 17:71295767-71295789 TATGTTTCTCACAGTTCTGCAGG + Intergenic
1152138832 17:78524594-78524616 TTTATTCCTCACCGTTCTGGAGG - Intronic
1153807964 18:8726324-8726346 TTTATTTCTGACAGTTCTGGAGG + Intronic
1155585714 18:27362143-27362165 TTTATTTCTCACAGTTCTGCAGG + Intergenic
1155713665 18:28912745-28912767 TTTGTAACTGACCGATCTGCAGG - Intergenic
1155913433 18:31532156-31532178 TTTGTTACTCACAGTTCTGAAGG + Intronic
1156594143 18:38526488-38526510 TTTATTACTCACAGTTCTGGGGG - Intergenic
1157151961 18:45227411-45227433 TTTGTTTCTCACAGTTCTGAAGG + Intronic
1158342084 18:56477507-56477529 TTTATTACTTACAGTTCTGGAGG - Intergenic
1158441013 18:57474435-57474457 TTTATTTCTGACAGTTCTGGAGG + Intronic
1158887894 18:61846100-61846122 TTTATTACTCACAGTTCTGGAGG - Intronic
1159003967 18:62996587-62996609 TTTATTGCTCACCGTTCTGGAGG - Intergenic
1159137758 18:64357038-64357060 TTTATTTCTCACAGTTCTGCAGG + Intergenic
1159832005 18:73288516-73288538 TTTGTTCCTTACTGTTCTGGAGG + Intergenic
1159949993 18:74475900-74475922 TGTATTACTGACAGTTCTGGAGG - Intergenic
1160525496 18:79533201-79533223 TTTGTTTCTGAGTGGTCTGCTGG + Intergenic
1160525811 18:79535153-79535175 TTTTTTCCTGACCATTCTGGTGG + Intergenic
1161721827 19:5907077-5907099 TTTGTTTCTCAGCGTTCTGGAGG + Intronic
1162636399 19:11971148-11971170 TTTGTTTCTGACAGTTCTTGAGG + Intronic
1162959596 19:14118028-14118050 ATTGACACTGAGCGTTCTGCTGG - Intronic
1163434425 19:17286755-17286777 TTTGTTACAGATGGTACTGCTGG + Exonic
1164924017 19:32112238-32112260 ATTGTTGCAGACAGTTCTGCTGG + Intergenic
1165190528 19:34059192-34059214 TTTATTTCTCACCGTTCTGAAGG - Intergenic
1166395397 19:42435982-42436004 TTTATTCCTCACAGTTCTGCAGG - Intronic
1167812135 19:51842555-51842577 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1168506600 19:56940408-56940430 TTTATTTCTGACAGTTCTGGAGG + Intergenic
1168548826 19:57276669-57276691 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1168587047 19:57602100-57602122 TTTGTTTCTCACAGTTCTGCAGG + Intronic
925643161 2:6006700-6006722 TTTGTTGCTCACAGTTCTGGAGG - Intergenic
925881282 2:8354919-8354941 TTTATTGCTGACAGTTCTGGAGG + Intergenic
926318576 2:11731039-11731061 TTTGTTACTAAACCTACTGCAGG - Intronic
926463047 2:13157447-13157469 TTTATTACTTACAGTTCTGCAGG + Intergenic
926503641 2:13684265-13684287 TTTGTTACTGACCACTTTGTTGG - Intergenic
926521723 2:13923771-13923793 TTTGTTACTGACCAGATTGCTGG - Intergenic
926712450 2:15892148-15892170 TTTATTACTAACATTTCTGCAGG + Intergenic
926732478 2:16046913-16046935 TTTGTTGCTCACAGTTCTGGAGG - Intergenic
926927019 2:17997041-17997063 TTTGTTACTGACCAGTTTGCTGG - Intronic
928382217 2:30828252-30828274 TTTGTTACTGACCAGCTTGCTGG - Intergenic
928459310 2:31456016-31456038 TTTGTTACTGACCAGCTTGCTGG + Intergenic
929584542 2:43105526-43105548 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
929698957 2:44145294-44145316 TTTGTTACTCACAGTTCTAGAGG - Intergenic
930995701 2:57714916-57714938 TTTGTTTCTGACTGTGCTTCGGG + Intergenic
931538381 2:63302827-63302849 TTTGTTACTGATCATTTTGTTGG - Intronic
932508110 2:72256254-72256276 TTTATTTCTAACCGTTCTGGAGG - Intronic
932525521 2:72462680-72462702 TTTGTTTCTCACAGTTCTGGAGG - Intronic
933269375 2:80216689-80216711 TTTGTTTCTCACCGTTCTGGAGG - Intronic
934969299 2:98750140-98750162 TTTATTTCTCACCGTTCTGGAGG - Intergenic
935026975 2:99286205-99286227 TTTATTACTTACAGTTCTGGAGG - Intronic
935865645 2:107384926-107384948 TTTGTTTCTCACAGTTCTGAAGG - Intergenic
936159786 2:110076219-110076241 TTTATTTCTCACAGTTCTGCAGG + Intergenic
936184879 2:110295134-110295156 TTTATTTCTCACAGTTCTGCAGG - Intergenic
936948572 2:117954026-117954048 TTTGTTGCTTACAGTTCTGAAGG - Intronic
938945028 2:136204666-136204688 TTTATTGCTCACAGTTCTGCGGG + Intergenic
938989779 2:136615969-136615991 TTTATTACTCACAGTTCTGGAGG - Intergenic
939843702 2:147219352-147219374 TTTGTAACTGACCAGTTTGCTGG + Intergenic
940001103 2:148966930-148966952 TTTATTACTTACAGTTCTGGAGG - Intronic
940123186 2:150291755-150291777 TTTATTACTGACAGTTCTGGAGG + Intergenic
940322574 2:152392472-152392494 TTTATTTCTCACCGTTCTGGAGG + Intronic
940629386 2:156218400-156218422 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
942426891 2:175869510-175869532 TTTGTTTCTCATAGTTCTGCAGG - Intergenic
942620235 2:177837313-177837335 TTTGTTACTGACCAGTTTGCTGG - Intronic
944483451 2:200180210-200180232 TTGGCCACTGAGCGTTCTGCAGG - Intergenic
944840758 2:203621554-203621576 TTTTTTTCTCACAGTTCTGCTGG - Intergenic
945111052 2:206360256-206360278 TTTCTTCCTGACAGTTCAGCAGG - Intergenic
946296489 2:218787777-218787799 TTTGTTTCTTACGGTTCTGGAGG - Intronic
946461293 2:219871087-219871109 TTTGTCACTGGCTGCTCTGCAGG + Intergenic
947124444 2:226852605-226852627 TTTATTTCTCACAGTTCTGCAGG - Intronic
947415432 2:229890546-229890568 TTTGTTTCTGACAGTTCCCCAGG - Intronic
948222678 2:236285464-236285486 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
948507049 2:238435465-238435487 TTTGGTGCTGATCATTCTGCAGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169955551 20:11098773-11098795 TTTGTTATTGATCTTTCTCCTGG + Intergenic
1170391944 20:15884798-15884820 TTTATTTCTGACAGTTCTGGAGG + Intronic
1170407781 20:16056957-16056979 TTTATTACTCACAGTTCTGGAGG - Intergenic
1170975597 20:21160940-21160962 TTTGTTTCTGATAGTTCTGGAGG - Intronic
1171442224 20:25174431-25174453 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1173752172 20:45486071-45486093 TTTGTAACTGACCAGTGTGCCGG + Intergenic
1174872724 20:54198694-54198716 TTTATTCCTGACAGTTCTGGAGG + Intergenic
1178193187 21:30310472-30310494 TTTCTAACTGACAGTTGTGCTGG - Intergenic
1178519939 21:33280980-33281002 TTTATTTCTCACAGTTCTGCAGG + Intronic
1178770772 21:35501600-35501622 TTATTTTCTTACCGTTCTGCAGG - Intronic
1178836144 21:36099200-36099222 TTTGTTACTGACTGTTCTGTTGG - Intergenic
1178938791 21:36887213-36887235 TTTGTTTCTCACCGTTCTGGAGG - Intronic
1179034212 21:37745928-37745950 TTTGTTTCTCACAGTTCTGAAGG + Intronic
1180226476 21:46396267-46396289 TTTGTGACTTACAGTTCTGGAGG + Intronic
1182742579 22:32579320-32579342 TTTATTGCTGACAGCTCTGCAGG + Intronic
949232307 3:1765864-1765886 TTTGTTTCTGACAGTTATGGAGG + Intergenic
949903353 3:8838123-8838145 TTTATTTCTCACCATTCTGCAGG - Intronic
950091843 3:10301257-10301279 CTTGTCACTGCTCGTTCTGCTGG + Exonic
950944631 3:16932085-16932107 TTTGTTTCTCACAGTTCTGAAGG - Intronic
951626332 3:24667778-24667800 TTTATTTCTCACAGTTCTGCAGG - Intergenic
952724751 3:36572290-36572312 TTTGTTGCTTACAGTTCTGAAGG + Intergenic
953153338 3:40344945-40344967 TTTGTTACTGACCAGTTTGTTGG - Intergenic
953416226 3:42719623-42719645 TTTGTAACTGACCAGTTTGCTGG - Intronic
954998476 3:54904026-54904048 TTTATTTCTTACAGTTCTGCAGG + Intronic
955797546 3:62653426-62653448 TTTGTTTCTCACAGTTCTGGAGG - Intronic
955912774 3:63874869-63874891 TTTGTTTGTGACAGTTCTGAAGG + Intronic
956140058 3:66137554-66137576 TTTTTTTCTCACAGTTCTGCAGG - Intronic
956743653 3:72294346-72294368 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
956984443 3:74681417-74681439 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
956992688 3:74786374-74786396 TTTGTTTCTTATAGTTCTGCAGG + Intergenic
957658487 3:83114563-83114585 TTTGTTTCTTACCATTCTCCAGG - Intergenic
957716017 3:83930176-83930198 TTTGTTACTGACCAGTTTACCGG - Intergenic
958750266 3:98187014-98187036 TTTGTTACTGACCGTTTTGTTGG + Intronic
958771736 3:98433889-98433911 TTAATTGCTGACAGTTCTGCAGG + Intergenic
958953059 3:100437033-100437055 TTTGTTTCTCACAGTTCTGGAGG - Intronic
961907093 3:130274258-130274280 TTTATTTCTGACAGTTCTGGAGG + Intergenic
961943780 3:130664063-130664085 TTGGTTACTGACTGGTCTTCTGG + Intronic
962004069 3:131330797-131330819 TTTGTTTCTCACAGTTCTGGAGG + Intronic
962021310 3:131504684-131504706 TTTCTTACAGACCGTACTGTAGG - Intergenic
963367684 3:144359102-144359124 TTTGTTATTTACAGATCTGCAGG - Intergenic
964331179 3:155605042-155605064 TTTATAACTGACCAGTCTGCTGG - Intronic
964679364 3:159320403-159320425 TTTGTTTCTCACGGTTCTGGAGG - Intronic
964961913 3:162437794-162437816 TTTGTTACTGGCCATTTTGTTGG + Intergenic
965149556 3:164952266-164952288 TTTGTTACTGACCAGCTTGCTGG - Intergenic
965552082 3:169977279-169977301 TTTGTTGCTGACCCTTCAGTAGG - Intronic
965968308 3:174523109-174523131 TTTGTTTCTCACAGTTCTGGAGG - Intronic
966632576 3:182094987-182095009 TTTGTTTCTTACAGTTCTGGAGG + Intergenic
967542193 3:190680587-190680609 TTTGTTACTAACCGTTTTGTTGG - Intergenic
968191073 3:196667796-196667818 TTTGATCCTGACTGTTCAGCAGG - Intronic
968375174 4:34149-34171 TGTGTTACTGACTGTTCAGGTGG + Intergenic
969343961 4:6559819-6559841 TTTATTTCTCACCGTTCTGGAGG - Intronic
970631030 4:17944857-17944879 TTTGTTTCTCACAGTTCTACAGG + Intronic
971814191 4:31465834-31465856 TTTGTAACTGACCAGCCTGCAGG + Intergenic
971968702 4:33594490-33594512 TTTGTTACTGACCATTTTGTTGG - Intergenic
972090006 4:35269659-35269681 TTTGTTTCTTACAGTTCTGGAGG + Intergenic
972215902 4:36896518-36896540 CTTGTTACTGACAGTTTTGTTGG - Intergenic
972332708 4:38078726-38078748 TTTGTTTCTCACAGTTCTGGAGG - Intronic
974376968 4:61090917-61090939 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
975057297 4:69949950-69949972 TTTGTTTCTGATAGTTCTGGAGG - Intergenic
975265218 4:72355736-72355758 TTTATTTCTCACAGTTCTGCTGG - Intronic
975863381 4:78701646-78701668 TATGTAACTGACCAGTCTGCAGG + Intergenic
976461580 4:85318967-85318989 TTTGTTACTGACCAGTTTGCTGG + Intergenic
976643525 4:87363479-87363501 TTTGTTACTGACCAGCTTGCTGG - Intronic
977191051 4:94001199-94001221 TGTGTTTCTCACAGTTCTGCAGG + Intergenic
977409229 4:96640259-96640281 TTTGTTCCTCACAGTTCTGGAGG + Intergenic
978019412 4:103788719-103788741 TTTGTTACTGACCATTTTGTTGG - Intergenic
978894824 4:113873952-113873974 TTTGTAGCTGACCAGTCTGCAGG - Intergenic
979847623 4:125535999-125536021 TTTATTTCTCACAGTTCTGCAGG + Intergenic
979940314 4:126753895-126753917 TTTTTTTCTGACAGTTCTGGAGG - Intergenic
980352775 4:131702172-131702194 TTTGTTTTTCACAGTTCTGCAGG + Intergenic
980586636 4:134825654-134825676 TTTATTGCTAACCGTTCTGTAGG - Intergenic
980642500 4:135598096-135598118 TTTATTACTGACCATTCTGCTGG - Intergenic
980882950 4:138732083-138732105 TTTTTTTCTGACAGTTCTGAAGG - Intergenic
980900734 4:138902686-138902708 TTTGTTTCTCACAGTTCTGAAGG + Intergenic
981016216 4:139977185-139977207 TTTATTTCTCACAGTTCTGCAGG - Intronic
981201015 4:141979522-141979544 TTTGTTACTGACCAGGTTGCTGG - Intergenic
982606865 4:157526824-157526846 TTTGTTACTAACCAGTTTGCTGG + Intergenic
982882322 4:160734908-160734930 TTTATTTCTCACCGTTCTGAAGG - Intergenic
983045537 4:162982516-162982538 TTTGTTACTCAGAGTTCTGGAGG + Intergenic
983768138 4:171512581-171512603 TTTATTTCTTACCATTCTGCAGG - Intergenic
983773838 4:171582497-171582519 TTTGTTACTGACCAATTTGCTGG + Intergenic
984190015 4:176594029-176594051 TTTGTTTCTCACAGTTCTGAAGG - Intergenic
984337387 4:178410416-178410438 TTTGTATCTGACAGTTCTCCAGG + Intergenic
985459869 4:190094895-190094917 TGTGTTACTGACTGTTCAGGTGG - Intergenic
985666315 5:1183272-1183294 TTTGTCTCTGCCCCTTCTGCGGG - Intergenic
986049065 5:4070257-4070279 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
986057602 5:4154132-4154154 TTTGTTTCTCACCGTTCTGGGGG - Intergenic
986241250 5:5961757-5961779 TTAGTAGCTGACCGTTCTGGAGG + Intergenic
986717175 5:10533101-10533123 TGTGTTTCTCACCGTTCTGGGGG - Intergenic
987166205 5:15201264-15201286 TTTGTTACTGACCAGTTTGCTGG + Intergenic
987636935 5:20555298-20555320 TTTGTTTCTCATAGTTCTGCAGG - Intronic
987652522 5:20761436-20761458 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
988743038 5:34100046-34100068 TTTGTTTCTCACAGTTCTGGAGG + Intronic
989350408 5:40479473-40479495 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
989744940 5:44817818-44817840 TTTGTTTCTCACAGTTCTGGAGG - Intronic
990290534 5:54346178-54346200 TTTGTTACTGACCAGCTTGCTGG - Intergenic
990316291 5:54586032-54586054 TGTGTTACTGACAGTGTTGCTGG - Intergenic
991100885 5:62791297-62791319 TTTGTTTCTTACAGTTCTGGAGG - Intergenic
992200533 5:74379526-74379548 TTTGTTTCTTACAGTTCTGGAGG + Intergenic
993107030 5:83611214-83611236 TTTGTTACTCACAGTTCTGGAGG - Intergenic
993745565 5:91592938-91592960 TTTGTTACTGACCAGTTTGCTGG + Intergenic
994248869 5:97513580-97513602 TTTATTTCTGACAGTTCTGGAGG + Intergenic
994562581 5:101395076-101395098 TTTGTTACTGACCAGATTGCTGG - Intergenic
1000049230 5:157547579-157547601 TCTGTTTCTCACAGTTCTGCTGG - Intronic
1000545218 5:162591685-162591707 TTTTTTTCTTACCATTCTGCAGG - Intergenic
1000701718 5:164458962-164458984 TTTATTACTTACAGTTCTGGAGG - Intergenic
1000741241 5:164973000-164973022 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1001446865 5:171792104-171792126 TTTATTACTCACAGTTCTGGAGG - Intronic
1002424925 5:179169337-179169359 TGTGTTACTCACTGTTCTGGGGG - Intronic
1002620990 5:180488164-180488186 TTTATTTCTTACAGTTCTGCAGG + Intergenic
1003251289 6:4431077-4431099 TTTATTACTTACAGTTCTGGAGG - Intergenic
1003402006 6:5798175-5798197 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1003614084 6:7639671-7639693 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1004285900 6:14320423-14320445 TTTCTTAGTGACCATTCTGAGGG - Intergenic
1004553522 6:16673158-16673180 TTTTTATCTGACAGTTCTGCAGG - Intronic
1004765532 6:18722343-18722365 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1006196763 6:32247952-32247974 TTTGTAACCGACCAGTCTGCAGG - Intergenic
1006274886 6:32995809-32995831 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1006825048 6:36928614-36928636 TTGGTTACTGACCCTTCCCCAGG - Intronic
1007326396 6:41064055-41064077 TGTGTTACTGAGAGCTCTGCTGG - Intronic
1008291448 6:49721180-49721202 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1009414844 6:63404494-63404516 TTTATTACTCACAGTTCTGGAGG + Intergenic
1010395133 6:75383039-75383061 CTTGTTACTCTCCATTCTGCTGG + Intronic
1010414679 6:75600168-75600190 TTTTTTTCTGATAGTTCTGCAGG + Intergenic
1011022718 6:82832431-82832453 TTTATTTCTCACAGTTCTGCAGG + Intergenic
1011341519 6:86320449-86320471 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1012200904 6:96404897-96404919 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1012386021 6:98683978-98684000 TTTGTTACTTACCCTCCTCCTGG - Intergenic
1013071085 6:106729939-106729961 TCTGTTGCTGACTGTTCTGGTGG - Intergenic
1013473923 6:110489781-110489803 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1014200776 6:118606697-118606719 TTTGTTACTGACCAGCTTGCTGG + Intronic
1014304997 6:119728587-119728609 TTTGTGACTGACAGTTAAGCTGG - Intergenic
1014653108 6:124065649-124065671 TTTATTTCTTACCGTTCTGGAGG - Intronic
1015345084 6:132147020-132147042 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1016662957 6:146602577-146602599 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1016854598 6:148654574-148654596 TTTGTTATTAAAGGTTCTGCAGG + Intergenic
1017051696 6:150399670-150399692 TTTGTTTCTCACAGTTCTGGAGG + Exonic
1017357376 6:153525209-153525231 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1018556017 6:165051337-165051359 TTTGTTACTGACCATTTTGTTGG - Intergenic
1018801834 6:167228650-167228672 TTTGTAACTGACCAGTCTGCTGG - Intergenic
1019076454 6:169392404-169392426 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1019621547 7:1994802-1994824 TTTGTTGCTCACGGTTCTGCAGG - Intronic
1020204971 7:6107269-6107291 TTTGTTAGTGATTGTTCTGAAGG + Intronic
1020933442 7:14429430-14429452 TTTATTACTCACAGTTCTGGAGG - Intronic
1021966118 7:25920796-25920818 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1023122216 7:36921155-36921177 TTTGTTGCTCACAGTTCTGGAGG - Intronic
1023816894 7:43958026-43958048 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1024197015 7:47069133-47069155 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1027496645 7:78895312-78895334 TTTGTTTCTAACAGTTCTGGAGG - Intronic
1027672364 7:81117839-81117861 TTTATTTCTGACGGTTCTGGAGG + Intergenic
1027785597 7:82575248-82575270 TTTGTTTCTCACAGTTCTGAAGG - Intergenic
1028175328 7:87650327-87650349 TTTATTGCTCACAGTTCTGCAGG + Intronic
1028389079 7:90294659-90294681 TTTGTAACTGACCAGTTTGCTGG + Intronic
1028767679 7:94578468-94578490 TTGGTTTCTGACCATTCTGTTGG + Intergenic
1028934901 7:96453952-96453974 TTTGTTCCTGAGAGTTTTGCTGG + Intergenic
1030126904 7:106162590-106162612 TTTGTTGCTCACAGTTCTGGAGG + Intergenic
1030658921 7:112198354-112198376 TTTGTTTCTCACAGTTCCGCAGG - Intronic
1030817317 7:114053704-114053726 TTTATAACTGACAGTTCTGAAGG - Intronic
1030874792 7:114800439-114800461 TTTGTTGCTGAACTTTCTACAGG + Intergenic
1031061341 7:117054770-117054792 TTTGTCACTGAACTCTCTGCTGG + Intronic
1031117773 7:117686765-117686787 TTTATTTCTTACAGTTCTGCAGG - Intronic
1031316744 7:120267923-120267945 TTTATTTCTTACGGTTCTGCAGG - Intergenic
1031535327 7:122927063-122927085 TTTGTTTCTTACAGTTCTGAAGG + Intergenic
1031656769 7:124365467-124365489 TTTATTTCTCACCGTTCTGGAGG + Intergenic
1032201792 7:129827436-129827458 TTATTTTCTGACCGTACTGCAGG + Intergenic
1032420664 7:131776501-131776523 TTTGTTTCTCACAGTTCTGAGGG + Intergenic
1033072592 7:138217978-138218000 TTTGTTACTGACCAGGCTACTGG + Intergenic
1033161732 7:139002791-139002813 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1033578094 7:142705287-142705309 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1033878903 7:145857299-145857321 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1034362264 7:150510416-150510438 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1035529306 8:338230-338252 TTTGTTCCTCACAGTTCTGGAGG - Intergenic
1036937148 8:13014328-13014350 TTTATTTCTCACCGTTCTGGAGG + Intronic
1038222572 8:25624646-25624668 TATTTTACTCACAGTTCTGCAGG - Intergenic
1038657829 8:29470265-29470287 TTTGTTTCTCACAGTTCTGAAGG + Intergenic
1039252278 8:35679839-35679861 TTTATTTCTTACCGTTCTGGAGG + Intronic
1040438356 8:47415720-47415742 TTTGTTTCTCACAGTTCTGCAGG - Intronic
1040832806 8:51696428-51696450 TTTATTTCTCACCGTTCTGGAGG - Intronic
1041049222 8:53916771-53916793 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1042691880 8:71508742-71508764 TTTGTTTCTCACAGTTCTGGAGG - Intronic
1042708686 8:71690884-71690906 TTTGTTATTTACGGTTCTGTAGG + Intergenic
1043158364 8:76815345-76815367 TTTGTTTCTTATAGTTCTGCAGG + Intronic
1043556873 8:81440083-81440105 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1044032879 8:87260357-87260379 TTTGTTAGTGACCATCTTGCTGG + Intronic
1046473495 8:114710436-114710458 TTTGTTACTCACCGTTATGGAGG + Intergenic
1046622698 8:116545092-116545114 TTTATTTCTTACAGTTCTGCAGG + Intergenic
1046884751 8:119353665-119353687 TTTCATACTCACGGTTCTGCAGG - Intergenic
1048098981 8:131326393-131326415 TTTATTACTGATGGTTCTGGAGG - Intergenic
1048465538 8:134662043-134662065 TTTATTTCTGACAGTTCTGGAGG + Intronic
1048840337 8:138560170-138560192 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1050657838 9:7848458-7848480 TTTGTTACTGACCAGCTTGCAGG - Intronic
1050701038 9:8339004-8339026 TATCTTGCAGACCGTTCTGCTGG + Exonic
1051219472 9:14832964-14832986 TTTGTTACTGACCGTTCTGCTGG - Intronic
1052215565 9:25962559-25962581 TTTGTTACTGACTATTTTGTTGG + Intergenic
1053082831 9:35191811-35191833 TTTGTTACTGACCATTTTGTTGG + Intronic
1053107444 9:35423788-35423810 TTAGTTACTGCCCTTTCTGCAGG + Intergenic
1053779940 9:41597539-41597561 TTTGTTTTTCACAGTTCTGCAGG - Intergenic
1054167897 9:61807782-61807804 TTTGTTTTTCACAGTTCTGCAGG - Intergenic
1054669649 9:67773122-67773144 TTTGTTTTTCACAGTTCTGCAGG + Intergenic
1054865470 9:69995947-69995969 TTTATTTCTGACAGTTCTGGAGG - Intergenic
1055649046 9:78389186-78389208 TTTATTACTCACAGTTCTGGAGG - Intergenic
1055735314 9:79322388-79322410 TTTGTTAGGGACCATTCTGTTGG + Intergenic
1056720077 9:89063949-89063971 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1056723866 9:89094909-89094931 GTTGTTAGTGACCATTCTGATGG - Intronic
1056889984 9:90482951-90482973 TGTGTTACTCACCATTCTGGAGG + Intergenic
1057163395 9:92907364-92907386 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1057510344 9:95673905-95673927 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1057871081 9:98718287-98718309 TTTGTTGCTCACAGTTCTGGAGG + Intergenic
1058438608 9:104987302-104987324 TTTGTTGCTCACAGTTCTGGGGG + Intergenic
1060006410 9:120003945-120003967 TTTGTTTTTGACAGTTCTGGAGG - Intergenic
1060048982 9:120363368-120363390 TTTATTTCTCACAGTTCTGCAGG - Intergenic
1060681516 9:125569093-125569115 TTTGTTACTGACCAACTTGCTGG - Intronic
1060853902 9:126899778-126899800 TTTATTTCTCACCGTTCTGGAGG + Intergenic
1061081756 9:128374986-128375008 TTTTTTTCTGACCAGTCTGCTGG + Intronic
1061785233 9:133023833-133023855 TTTGTTTCTCACAGTTCTGGAGG + Intergenic
1061830692 9:133292236-133292258 TTTGTAATTGACCAGTCTGCTGG + Intergenic
1062681433 9:137784092-137784114 TTTATTTCTCACAGTTCTGCAGG + Intronic
1203574050 Un_KI270744v1:160001-160023 TGTGTTACTGACTGTTCAGGTGG - Intergenic
1185699769 X:2222141-2222163 TTTGTTGCTCACAGTTCTGGAGG - Intronic
1185969025 X:4641116-4641138 TTTGTTGCTCACAGTTCTGGAGG - Intergenic
1186148953 X:6653982-6654004 TTTATTTCTGACAGTTCTGGAGG - Intergenic
1186472363 X:9831691-9831713 TTTGTTGCTCACAGTTCTGGGGG + Intronic
1186504596 X:10081147-10081169 TTTGTTTCTCACAGTTCTGGAGG + Intronic
1187057888 X:15758217-15758239 TTTGTTGCTCACAGTTCTGGAGG + Intronic
1187150107 X:16673314-16673336 TTTGTTATTGACCAGTTTGCTGG - Intronic
1188133883 X:26470742-26470764 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1188622254 X:32240489-32240511 TTTATTTCTCACCGTTCTGGAGG - Intronic
1189054367 X:37684088-37684110 TTTGTTATTGGTTGTTCTGCAGG + Intronic
1189086530 X:38031015-38031037 TTTGTAACTGACCAGTTTGCTGG + Intronic
1189632876 X:42974005-42974027 TTTGTTACTGACCATTTTACTGG + Intergenic
1189649985 X:43178345-43178367 TTTGCTACTGACCAGTTTGCTGG - Intergenic
1189719009 X:43895819-43895841 TTTGTTTCTCACAGTTCTGGAGG - Intergenic
1189880421 X:45485913-45485935 TTTATTACTCACAGTTCTGGAGG - Intergenic
1190815562 X:53925958-53925980 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1190993895 X:55585306-55585328 TTTGTTTCTAACAGTTCTGCAGG - Intergenic
1192777049 X:74256010-74256032 TTTGCCACTGACCGCTTTGCTGG - Intergenic
1194040840 X:88940574-88940596 TTTGTAACTGAGCAGTCTGCTGG + Intergenic
1194331749 X:92591532-92591554 TTTGTAACTGACCAACCTGCAGG - Intronic
1195559053 X:106262511-106262533 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1196830385 X:119771317-119771339 TTTGTTGCTCACTGTTCTGTAGG + Intergenic
1197065437 X:122227985-122228007 TTTGTTACTGACCAGATTGCAGG - Intergenic
1197509291 X:127350919-127350941 TTTGTTACTAACCTGTTTGCTGG - Intergenic
1198541346 X:137643494-137643516 TTTATTTCTGACAGTTCTGGAGG + Intergenic
1201320994 Y:12698513-12698535 TTTGTTACTGACCACTTTGATGG + Intergenic
1201912859 Y:19151246-19151268 TTTATTGCTGACAGTTCTGGAGG + Intergenic