ID: 1051227012

View in Genome Browser
Species Human (GRCh38)
Location 9:14910002-14910024
Sequence TAAAGGGCTTTGAGAGGAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051227005_1051227012 26 Left 1051227005 9:14909953-14909975 CCTTGGAACTGGCGGGCAGGATA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG 0: 1
1: 0
2: 2
3: 47
4: 353
1051227004_1051227012 27 Left 1051227004 9:14909952-14909974 CCCTTGGAACTGGCGGGCAGGAT 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG 0: 1
1: 0
2: 2
3: 47
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051227012 Original CRISPR TAAAGGGCTTTGAGAGGAAG GGG Exonic
901197311 1:7447404-7447426 TGAAGGGCTTTGAGTGGGGGCGG + Intronic
902528432 1:17074824-17074846 CACAGGGCCTTGACAGGAAGTGG - Intronic
903842664 1:26255300-26255322 CAAAGGGAGTTTAGAGGAAGAGG - Exonic
903870411 1:26430026-26430048 TAAAAGGCTTTGAGGAGTAGGGG - Intergenic
904428824 1:30448779-30448801 TAAAGGACTTTGATGGGGAGAGG + Intergenic
904914698 1:33961319-33961341 TAATGGGATTTTAGAGGCAGAGG - Intronic
904926491 1:34053024-34053046 TAAGTGGCTTTGGAAGGAAGAGG + Intronic
905202513 1:36323687-36323709 AAAAGGGCTGGGAGAGGAAGGGG + Intronic
905740087 1:40362365-40362387 TGAAGGGCTGAGAGAGGATGTGG + Intronic
906124331 1:43417859-43417881 TCAAGGTCTTTCATAGGAAGAGG + Intronic
907220155 1:52900907-52900929 CACAGGGCTTTGAGAGGCTGAGG + Intronic
907490978 1:54808625-54808647 TGGAGGGCTTTGACAGGAAGAGG + Intronic
907971777 1:59389937-59389959 TAAAGGTGTCTGAGAGTAAGGGG + Intronic
908274054 1:62450842-62450864 TAAAGGAGTATGAGGGGAAGTGG + Exonic
908714926 1:67059427-67059449 TAAAGGTCTGTGAGAAGAGGAGG - Intergenic
908731258 1:67228888-67228910 AAAAGGGAATTGAGAGGAAGTGG - Intronic
909635232 1:77810390-77810412 CAAACTGCTTTGAGAGGAATGGG - Intronic
909944885 1:81652781-81652803 GAGAGGGCTTTGATTGGAAGAGG - Intronic
911053676 1:93693296-93693318 TGAAAGGTTTTGTGAGGAAGAGG - Intronic
911054177 1:93696642-93696664 TGAAGGGCTTTAAGTGGTAGAGG - Intronic
911238888 1:95442968-95442990 TAGAGGGTATTGAGAGGAAATGG + Intergenic
911484392 1:98487551-98487573 TTAAGGGCATGGAGAAGAAGAGG + Intergenic
912739599 1:112181869-112181891 TAAAGGGGTGTGTGAGAAAGTGG - Intergenic
914096333 1:144547084-144547106 TAAACAGCTTTGAAAGGAAACGG - Intergenic
914302182 1:146386879-146386901 TAAACAGCTTTGAAAGGAAACGG + Intergenic
914830810 1:151169679-151169701 GAAAGGACTTTGAGTGGTAGTGG - Exonic
915211440 1:154312656-154312678 GATAGGGAGTTGAGAGGAAGGGG - Intergenic
915212554 1:154321350-154321372 GATAGGGAGTTGAGAGGAAGGGG - Intronic
915444031 1:155964596-155964618 GAAAGGGTTTTGAGAGGTAGGGG + Intronic
915629659 1:157142471-157142493 AAAAGGGAAATGAGAGGAAGGGG - Intergenic
916618273 1:166467825-166467847 TAAAATGCTTTAAGAGGCAGAGG + Intergenic
916705385 1:167343996-167344018 GAAAGGGCTGGTAGAGGAAGAGG + Intronic
916822150 1:168410110-168410132 TAAAGGACCATGAGAGGAAATGG + Intergenic
916913924 1:169385204-169385226 TAAAGGTCTGGGAGAAGAAGGGG - Intronic
916941899 1:169685731-169685753 TAGGGGGATATGAGAGGAAGTGG - Intronic
918168112 1:181969995-181970017 AAAAGGTTTTTGGGAGGAAGAGG + Intergenic
918519716 1:185402847-185402869 TAAAGGGGATTGAGAGGGAAGGG + Intergenic
918884435 1:190172963-190172985 GACAGGGCTTTGAGATTAAGTGG + Intronic
920088416 1:203434790-203434812 TGAAGGGCTTGGAGAAGAAGAGG + Intergenic
920200196 1:204255449-204255471 TAAAGGGCTTTGAAGAGAAGGGG + Intronic
920273725 1:204787913-204787935 TAAAGGGCTTTTGGAGGAGGTGG - Intergenic
922121084 1:222669420-222669442 CAAACTGCTTTGAGAGGAATGGG - Exonic
922995770 1:229958773-229958795 TAAAGGGGTTTGAGAACAAATGG + Intergenic
924256476 1:242188224-242188246 TAAAGAGTTTTGAGATGAAGTGG + Intronic
1063251678 10:4281234-4281256 AAAAGGGCTTTGAGATTCAGGGG + Intergenic
1065515487 10:26520059-26520081 AAAAGGACTTTGAGAGGACAAGG + Intronic
1065708438 10:28492587-28492609 CAAATTGCTTTGGGAGGAAGTGG + Intergenic
1066055585 10:31677678-31677700 CAAAGGCCTGTGTGAGGAAGGGG - Intergenic
1066267894 10:33794182-33794204 TGATGGGGTTTGAGAGAAAGAGG - Intergenic
1066978724 10:42391962-42391984 AAAAGGGGTTTCAGAAGAAGGGG + Intergenic
1067190878 10:44067130-44067152 TAAAGGTGTTTGAGAAGCAGTGG + Intergenic
1067707770 10:48623627-48623649 CAAAGGGCTTTGAGGGATAGAGG - Intronic
1068624856 10:59232054-59232076 TAAAGTACTGTGAGAGAAAGAGG + Intronic
1068679817 10:59807659-59807681 TAAAGTGCTTTAAGTAGAAGAGG + Intronic
1069340605 10:67403838-67403860 GACAGAGCTCTGAGAGGAAGGGG + Intronic
1069852486 10:71419137-71419159 TAGAGGGCAGGGAGAGGAAGTGG - Intronic
1071919392 10:90332279-90332301 TAATGGGCTATGAGTTGAAGAGG + Intergenic
1072559392 10:96556988-96557010 TTAAGGGCTTTGCGGGGGAGGGG - Intronic
1072758997 10:98040488-98040510 TTACTTGCTTTGAGAGGAAGAGG + Intergenic
1074317815 10:112375290-112375312 TGAAGGGCTGGGAGACGAAGTGG - Intronic
1075096401 10:119474336-119474358 TGAAGGGCTTTGAGAGGCTTGGG - Intergenic
1075545203 10:123350090-123350112 CAAAGGGCCTTTGGAGGAAGGGG + Intergenic
1075978779 10:126719546-126719568 TAAAGGGATTTGCTAGGAGGGGG - Intergenic
1078595281 11:12681063-12681085 TCAAAGGCTTTGAGATGAAAAGG - Intronic
1078650792 11:13190271-13190293 AAAAGGGATTTGTGAGGATGTGG - Intergenic
1079277769 11:19057650-19057672 TGCAGGGCTTTGAGGGGAAAAGG + Intronic
1083403914 11:62443713-62443735 TAAAGGGCTGAGAGAGGCTGAGG - Intronic
1083751478 11:64763292-64763314 TTAAGGTTTTGGAGAGGAAGTGG - Intergenic
1084234466 11:67777818-67777840 TAAAGGAGATGGAGAGGAAGGGG + Intergenic
1084951500 11:72668721-72668743 GAAAGGGCTTGGTGAAGAAGGGG - Intronic
1085274166 11:75287572-75287594 TCAAGGGTTTTGGGAGGAAGTGG - Intronic
1085672169 11:78477349-78477371 GCAGGAGCTTTGAGAGGAAGGGG - Intronic
1086938912 11:92774855-92774877 GAAAGGGCATTGAGAGCAGGAGG + Intronic
1087269083 11:96092813-96092835 TGAAGGGATTGGAGACGAAGTGG + Exonic
1088715712 11:112547430-112547452 TCCAGGGCTCTGAGAGGAAGGGG - Intergenic
1090664754 11:128907002-128907024 TAAAGGGCCTTGAGGGGACTGGG + Intronic
1090929520 11:131283050-131283072 AAAACTGCTTTGAGAGAAAGCGG + Intergenic
1091431536 12:439528-439550 AAAAGGACTTTGGGAGGCAGAGG + Intronic
1092192306 12:6529743-6529765 GGAAGGGCTTTGTGAGGAACTGG - Intronic
1092509826 12:9143460-9143482 AAAAGGGGTTTCAGAGGAAGGGG + Intergenic
1093766509 12:22969558-22969580 TAATTGGCTTTTAAAGGAAGAGG + Intergenic
1094677956 12:32639516-32639538 AAAAGGAGTTTGAGAGGAAGGGG + Intronic
1094865968 12:34530355-34530377 GACAGGGCTTTGAGAGCAACTGG - Intergenic
1096692645 12:53330523-53330545 TAAATGGCTGTGAGAAGAACTGG + Intronic
1097359229 12:58640111-58640133 TAAAGAGCTTACAGAGGAGGAGG - Intronic
1098041884 12:66361175-66361197 TCAGGGGTTTTGAGAGGAATTGG + Intronic
1099757419 12:86870969-86870991 TAGAGGGCTGGTAGAGGAAGAGG - Intergenic
1099923019 12:88982651-88982673 TTAAGGATTTTGAGATGAAGCGG - Intergenic
1100134585 12:91539370-91539392 AAAAGGGCTTTGAGTGATAGAGG - Intergenic
1100752288 12:97711931-97711953 TAAAGTGCTTAGAGAATAAGGGG + Intergenic
1101514502 12:105421745-105421767 AAAAGGACTTTGAGGGGATGTGG - Intergenic
1101723422 12:107370530-107370552 GAAAGGGCTGAGAGAGGAAGGGG - Intronic
1101824636 12:108210452-108210474 CAAAGGGCTCTGTGAGGGAGTGG - Intronic
1101831136 12:108257447-108257469 GAAGGGGCTGGGAGAGGAAGAGG + Intergenic
1103659986 12:122506492-122506514 TCCAGGGCTTTGAGAGGCCGAGG + Intronic
1105973310 13:25451041-25451063 AAAAGGGGTTAGAGAGGAAAAGG - Intronic
1107119326 13:36779460-36779482 GATAGAGCTTTCAGAGGAAGGGG + Intergenic
1107211350 13:37858789-37858811 TAATGGGGGTTGAGAGGGAGTGG + Intronic
1107453993 13:40537484-40537506 TAAAGGGCTTTGGGAGGTTGAGG - Intergenic
1107666982 13:42700513-42700535 GAAAGGCCTTTGTGAGGAGGTGG - Intergenic
1110122903 13:71905326-71905348 TCCAGTGCTTTGAGAGGCAGAGG - Intergenic
1110334508 13:74311636-74311658 TTAAGAGCTTTGAAAGAAAGAGG + Intergenic
1110598221 13:77341916-77341938 GAAGGGGCATAGAGAGGAAGTGG - Intergenic
1110711076 13:78651658-78651680 TGAAGGGCTTGCAGAGGAGGTGG - Intronic
1112331139 13:98477847-98477869 CAAAGGGCGCTAAGAGGAAGAGG + Intronic
1114482892 14:23046389-23046411 TAAAAGACTAAGAGAGGAAGGGG - Intergenic
1115747495 14:36452279-36452301 TTAAGGACCTTGAGAGGAGGGGG + Intergenic
1115754052 14:36516343-36516365 TAAATGGCTTTGAGGGGCGGGGG - Intergenic
1115804070 14:37031301-37031323 TGAAAGGCTTTAAGAGGAAAAGG - Intronic
1115910689 14:38254424-38254446 TAAAGGGAATTTAGAGGAAGGGG + Exonic
1116206525 14:41874571-41874593 TAAAGTGCATTATGAGGAAGAGG - Intronic
1116732096 14:48636735-48636757 CAAAGGACTTTGAAAGGAAGTGG - Intergenic
1117013627 14:51495746-51495768 TAAAGGAATTGGAGAGGTAGAGG + Intronic
1117790559 14:59336565-59336587 TAAAGGACTTTTAAAAGAAGTGG + Intronic
1119325720 14:73758856-73758878 TAAAGGTCTAGGGGAGGAAGGGG - Intronic
1119476730 14:74934812-74934834 GAGAGGGCTTTGAAAGGGAGAGG + Intergenic
1120024213 14:79564277-79564299 AAGAGGGCATTGAGAGAAAGTGG + Intronic
1120521919 14:85534042-85534064 GGAAGGGCTCTGGGAGGAAGCGG - Intronic
1121073678 14:91048775-91048797 TAAAGTGCTGTGGGAGGGAGGGG - Intronic
1121790532 14:96696357-96696379 AAGAGGGCTTTGAGAGTCAGAGG - Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1124165598 15:27323033-27323055 TAAAGTGCTTTATGGGGAAGGGG + Intronic
1125022988 15:35003383-35003405 TAATGTGCTGTCAGAGGAAGTGG + Intergenic
1125039112 15:35162559-35162581 GAAAGGCCTTTGTGAGGAAGTGG - Intergenic
1125348380 15:38742438-38742460 TAGAGGGCTTCTAGGGGAAGAGG - Intergenic
1125986524 15:44058534-44058556 TAATGGGCTTTGGGAGGCCGAGG + Intronic
1126753274 15:51899042-51899064 CAAAGGCCATTGAGAAGAAGGGG - Intronic
1127388392 15:58485814-58485836 TCAATGCCTTTGAGAAGAAGGGG - Intronic
1129178004 15:73853959-73853981 TAAATGGATTGGAGAGGAGGTGG + Intergenic
1129669485 15:77599215-77599237 TAAGGGGCTTTAAGAGGCAGGGG + Intergenic
1130105719 15:80927215-80927237 TGAAGGGCATTTAGGGGAAGGGG + Intronic
1130245281 15:82242056-82242078 CTAAGGGCTTTGATAGGATGTGG - Intronic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130397513 15:83516087-83516109 TAATAGGCTATGAGAGGAGGGGG + Intronic
1130567888 15:85013252-85013274 AAAAGGGCTTTGAGATGTGGTGG + Intronic
1133851788 16:9511581-9511603 CAAAGGGCGGTGTGAGGAAGAGG + Intergenic
1136984026 16:35083384-35083406 TATAGGGCTCTGTCAGGAAGTGG - Intergenic
1138205272 16:55120019-55120041 TAGAGGTCTTTGGGAGTAAGGGG - Intergenic
1140869048 16:79090011-79090033 GAACTGGCTTTGACAGGAAGTGG + Intronic
1140873971 16:79133263-79133285 TAAAGGGCTGTGATCTGAAGGGG - Intronic
1142199161 16:88753035-88753057 GAAAAGGCTCAGAGAGGAAGAGG + Intronic
1142844042 17:2658249-2658271 TAAAGGTCTAAGAGAGAAAGGGG - Intronic
1142928709 17:3264026-3264048 TAAAGGACTTTAAGCCGAAGAGG - Intergenic
1143341954 17:6218585-6218607 TGAATGGTTTTGAGACGAAGAGG - Intergenic
1144255700 17:13464963-13464985 TAAAGAGCTATGGGAAGAAGAGG + Intergenic
1144431860 17:15199330-15199352 GACAGAGCTCTGAGAGGAAGGGG + Intergenic
1144447127 17:15341546-15341568 GAAGGGGCTGTGGGAGGAAGGGG + Exonic
1144637306 17:16918406-16918428 GGAAGGGTTTTGAGGGGAAGGGG + Intergenic
1144787602 17:17840531-17840553 TAAGAGGCTTGGAGAGGAAGCGG - Intergenic
1146147022 17:30427950-30427972 TGAAGAACTATGAGAGGAAGAGG - Intronic
1146711853 17:35048829-35048851 TAAAGGTCTGTGGGAGGAAGGGG - Intronic
1146911230 17:36649740-36649762 TAATGGGCTTGGAGAGGTGGTGG + Intergenic
1147168476 17:38605350-38605372 TAAAGGGGCTTGTGTGGAAGGGG - Intronic
1147268235 17:39247813-39247835 AAAAGGGATTTTAGAGGCAGAGG + Intergenic
1147690800 17:42313201-42313223 GAAAGGGTCTTGAGAGGAGGTGG - Intergenic
1148027730 17:44600145-44600167 GAAAGGGCTGGGGGAGGAAGGGG - Intergenic
1148993171 17:51684049-51684071 TTAAGGGTCTTGAGAAGAAGGGG + Intronic
1149609995 17:57953218-57953240 TAAAGGGATTTGGGTGGAGGTGG - Intronic
1150130938 17:62668626-62668648 TAAAGGGCATGGTGAAGAAGAGG + Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1151234652 17:72710974-72710996 TAAAGGGCTTTAAAAGGGGGAGG - Intronic
1151456621 17:74230150-74230172 TAAAGGGGTTAGAGGGGAGGGGG + Intronic
1151665611 17:75543655-75543677 TAAAGGGCTTTTATAGAAAAGGG + Intronic
1151766389 17:76135483-76135505 AAAGGGGCTTTGGGAGAAAGGGG + Intergenic
1152982233 18:289514-289536 AAAAGGGCTTTGAAAGTAAGGGG + Intergenic
1153223307 18:2880381-2880403 GAAAAGGGTTTTAGAGGAAGAGG + Intronic
1154154472 18:11933077-11933099 CACAGTGCTTTGAGAGGCAGAGG - Intergenic
1154396848 18:13998616-13998638 TAGAGGCCTTTGAGAGGCACGGG + Intergenic
1155585295 18:27357209-27357231 AAAAGGGTTTTGAAGGGAAGAGG - Intergenic
1157155954 18:45266244-45266266 TAATGAGCTAAGAGAGGAAGTGG + Intronic
1157297258 18:46455324-46455346 TAAAGGGTGTTGAGGGGGAGTGG + Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161978565 19:7619231-7619253 AGAAGGGCTCTGAGAGGCAGGGG + Intergenic
1163524867 19:17814670-17814692 TCCAGGGCTTTGGGAGGCAGAGG + Intergenic
1164378722 19:27712613-27712635 GAAAGGGTTTTGAGAGCAACCGG + Intergenic
1164409638 19:27990143-27990165 TAAAGGGAATTGAGAAGAGGAGG - Intergenic
1164658394 19:29941279-29941301 CAAAGGGCTGTAGGAGGAAGTGG + Intronic
1164912528 19:32024718-32024740 TTAAGGTCACTGAGAGGAAGCGG - Intergenic
926362965 2:12107383-12107405 CAAAGTACTTTGAGGGGAAGTGG + Intergenic
926594476 2:14775465-14775487 TAAAGGGCTTGGAGTGGAGCAGG - Intergenic
926611658 2:14953756-14953778 GATTGGGCTGTGAGAGGAAGAGG + Intergenic
926960863 2:18357064-18357086 GAAAGGGTTTTTAGAGGAAGGGG + Intronic
927342443 2:21997696-21997718 TAACAGGCTTTGAGAGGAAGAGG + Intergenic
927896884 2:26788519-26788541 GGAAGGGCTTTGATAGGAAGGGG - Intronic
928327853 2:30334164-30334186 GAAAGGGCTTGGGGAGGCAGAGG + Intergenic
929045696 2:37786853-37786875 TTAAGTGCTTTGTGTGGAAGTGG + Intergenic
929655180 2:43723784-43723806 TGGAGGGCTTTGAGCGGAACAGG + Intronic
930228058 2:48814398-48814420 TAATGGTATTTGAGAGGAAGTGG + Intergenic
930370006 2:50490259-50490281 TAAAGGGTTTTGAGAAGCAGAGG - Intronic
931071868 2:58660539-58660561 TACAGCACTTTGAGAGGCAGAGG + Intergenic
931514385 2:63036778-63036800 TATTGGCCTTTGTGAGGAAGTGG + Intronic
932257280 2:70298836-70298858 TAAAGTGCTTTAAGAAGGAGAGG + Intronic
932523570 2:72440041-72440063 TACAGAGCTCTCAGAGGAAGGGG - Intronic
933111444 2:78407092-78407114 GCAAGGGTTTTGAGAAGAAGGGG - Intergenic
933294423 2:80472891-80472913 CAAAGGGCTAGGAGAGGATGAGG + Intronic
934518891 2:95007066-95007088 GAAATGGCTTTGAGGAGAAGGGG - Intergenic
936054987 2:109255910-109255932 TCAAGGCCTTTGAAAGGAAGGGG + Intronic
936659318 2:114524691-114524713 TATAGGGATTTTAGAGGAAGAGG + Intronic
936938798 2:117861897-117861919 GAGAGAGCTCTGAGAGGAAGAGG + Intergenic
937394733 2:121524929-121524951 GAAAGGGCCTGGAGAGCAAGAGG + Intronic
938282222 2:130072475-130072497 TACAGAGCTTCCAGAGGAAGGGG - Intergenic
938332849 2:130461047-130461069 TACAGAGCTTCCAGAGGAAGGGG - Exonic
938356958 2:130659624-130659646 TACAGAGCTTCCAGAGGAAGGGG + Intergenic
938433394 2:131266430-131266452 TACAGAGCTTCCAGAGGAAGGGG + Intronic
939597144 2:144139258-144139280 TATAGGACTGTGAGAGGCAGAGG + Intronic
940065872 2:149628354-149628376 TAAAGGGCTTTGAAAGCACTTGG + Intergenic
940343034 2:152601210-152601232 TACAGAGCTTTGGGAGTAAGGGG - Intronic
941134709 2:161699687-161699709 TAAAGGGCTTTGAGAAAGGGAGG + Intronic
941772161 2:169356647-169356669 TACAGTGTTTTGAGATGAAGTGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943484113 2:188457615-188457637 TAAAGGGATATGATAAGAAGAGG + Intronic
944507257 2:200425283-200425305 TATAGGGCTTAGAGAAGCAGGGG - Intronic
947821264 2:233072580-233072602 TAAATGGCATTGAGAAGAAGTGG - Intronic
947925033 2:233913942-233913964 TCAAGGGCTTTGTGTGGATGAGG + Intergenic
948111529 2:235460125-235460147 TCAGGTGCTGTGAGAGGAAGGGG - Intergenic
948502154 2:238403469-238403491 TAAAGGACTTTTAATGGAAGAGG + Intergenic
948901476 2:240958756-240958778 GGGAGGGCCTTGAGAGGAAGCGG + Intronic
1169737118 20:8849092-8849114 GAAAGAGCTTTGAGAAGCAGAGG - Intronic
1169983449 20:11413387-11413409 TCTAGGGCTTTCAGAGGCAGGGG - Intergenic
1171427898 20:25059871-25059893 TACAGGGCACTGAGAGGCAGAGG + Intergenic
1173612157 20:44377282-44377304 CAAAGGGGTTAGAGAGGGAGGGG + Intronic
1173749320 20:45464343-45464365 GAAAGGGGTTTGAGATCAAGAGG + Intergenic
1174280747 20:49437381-49437403 TGGAGGGCTTTGAGCAGAAGAGG + Intronic
1176229645 20:64025617-64025639 TCAGGGGCTTTGAGAGGGCGTGG + Intronic
1178419907 21:32435146-32435168 TAAAGGAGATGGAGAGGAAGGGG - Intronic
1178511900 21:33212337-33212359 CAAAGGGTTCTGGGAGGAAGTGG - Intergenic
1181283973 22:21739134-21739156 GAAAGGGGTTAGGGAGGAAGTGG - Intergenic
1181880290 22:25973819-25973841 AAAAGGGATTGGAAAGGAAGTGG - Intronic
1182847461 22:33443361-33443383 TAAAGGGCACAGAGAGGAAGGGG + Intronic
1183118735 22:35713131-35713153 AGCAGGGCTTTGGGAGGAAGAGG - Intergenic
1184087446 22:42273528-42273550 TAATGTGATTTCAGAGGAAGGGG - Intronic
1184569293 22:45311647-45311669 TGAAGGGCTTTGGGAGGAGAGGG + Intronic
949148490 3:734175-734197 TCAAGCACTTTGAGAGGACGAGG + Intergenic
950114521 3:10442038-10442060 ACAAAGGCTTGGAGAGGAAGGGG - Intronic
950250301 3:11459649-11459671 TAATGGGCTTTGTGGGGAAAAGG + Intronic
950330611 3:12153303-12153325 TAATGGGGTTTGGGAGGCAGGGG + Exonic
951304919 3:21047838-21047860 AAAAGGAATTTGAGGGGAAGAGG - Intergenic
951633818 3:24751134-24751156 TAAAAGGCTTTCAGAAGAAAGGG - Intergenic
952127943 3:30324106-30324128 TAAAGGGTAGTGAGAGGGAGAGG + Intergenic
952636393 3:35537854-35537876 TACTGGGTTTTGAGAGGAAATGG + Intergenic
953891316 3:46753596-46753618 GAAAGGGCATTGAGAAGGAGTGG + Intronic
953896798 3:46809264-46809286 GAAAGGGCATTGAGAAGGAGTGG + Intronic
954337983 3:49931057-49931079 TGTAGGGCTTAGAGAGGAAAAGG - Intergenic
955584574 3:60462631-60462653 TAAAGGGCTTGGAGAGCAGGAGG + Intronic
956016006 3:64883654-64883676 CAAAGAACTTTGAGAAGAAGAGG + Intergenic
956627727 3:71283124-71283146 GAAAGGGCTGAGAGAGGGAGAGG + Intronic
956633272 3:71337156-71337178 GAAAGGGCTGTGAGTGGAACAGG + Intronic
958127335 3:89373839-89373861 TATAAGGCTTTGAGATGTAGAGG + Intronic
958190378 3:90176697-90176719 TAAAAGAATTAGAGAGGAAGGGG + Intergenic
958412053 3:93830294-93830316 TAAAAGAATTAGAGAGGAAGGGG + Intergenic
960973228 3:123154017-123154039 GAAAGGGCTGAGAGAGGAGGGGG + Intronic
961640116 3:128359942-128359964 GGAAGGACTTTGAAAGGAAGGGG - Intronic
962503457 3:136019751-136019773 TAAAGGGCTTAGAAAAGAACTGG - Intronic
965320128 3:167243644-167243666 TAAAGGGCTTTGGAAGGCCGAGG - Intronic
965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG + Intronic
965771300 3:172184168-172184190 AAAAGGGCTTTGAGGGGAATGGG - Intronic
966387913 3:179421209-179421231 TTAAGGGCTGTGAGAGAAAAAGG - Intronic
966394104 3:179483942-179483964 TAAACAGCTTTGAGAGGGAATGG - Intergenic
967823646 3:193861295-193861317 GGAAGGGCTATGACAGGAAGGGG + Intergenic
968746759 4:2364402-2364424 TGAAGGGCTTGGAGAGGTGGGGG - Intronic
968779941 4:2572753-2572775 TGAAGGGCTTTGAGCAGAGGAGG + Intronic
969394813 4:6913414-6913436 TTAAGGGAGCTGAGAGGAAGGGG + Intronic
970368825 4:15387678-15387700 TCAAGGACTTTGAGATGAAAGGG + Intronic
971607855 4:28681633-28681655 TTAAGGGCTTTTACAGGAAAAGG - Intergenic
972426666 4:38939752-38939774 TAAAGGGATTGGAGAGAGAGAGG - Intronic
973163741 4:47051539-47051561 TAAAAGCCTTTATGAGGAAGTGG - Intronic
973730811 4:53820673-53820695 TGAAGGCTTTTGAGAGGAGGTGG - Intronic
973822336 4:54673309-54673331 TAAAAGGATTTGAGAGAAAGTGG - Intronic
973917825 4:55654540-55654562 TAAATGGCTTTCAGTGGAAAGGG + Intergenic
973973974 4:56243906-56243928 TAAGGGGCTTTGAGGGAGAGGGG - Intronic
974818157 4:67032848-67032870 TCAAAGGCTTTGAGTGTAAGTGG + Intergenic
977840658 4:101699739-101699761 CTAAGGGATTTGAGAAGAAGAGG - Intronic
978023886 4:103848431-103848453 GACAGGGCTTTGAGAGCAACCGG + Intergenic
978375616 4:108072459-108072481 TAAGGGGCTTTCAAAGGAAACGG - Intronic
979304387 4:119125542-119125564 CAAAGTGGTTTGAGAGAAAGTGG + Intergenic
979558031 4:122073274-122073296 TGAAAGGCTCTGAGAGAAAGAGG + Intergenic
980154830 4:129091982-129092004 TCAGGGGATTTGAGAGAAAGAGG - Intronic
983185880 4:164700046-164700068 GAAAGGGAATTGAGAAGAAGCGG + Intergenic
983564727 4:169137771-169137793 AACATGGCTTTGTGAGGAAGCGG - Intronic
984371111 4:178865222-178865244 TAAAGTGCTTTGAGAGTTTGAGG - Intergenic
984916072 4:184725937-184725959 TAGAGAGCTTGGAGAAGAAGAGG + Intronic
984927551 4:184819837-184819859 TGAAGGCCTTTGTTAGGAAGAGG - Intronic
985155484 4:186983187-186983209 TAAACTCCTTTCAGAGGAAGGGG + Intergenic
986295315 5:6432564-6432586 TAAAGGGTTTCGAGAGGTGGAGG - Intergenic
986821666 5:11473917-11473939 TAAAAATATTTGAGAGGAAGGGG - Intronic
987759441 5:22141484-22141506 TAAAAGCCTTAGAGAGGAGGAGG + Intronic
987767590 5:22253723-22253745 TTAAGGGTTATGAGAGGAGGAGG - Intronic
989572001 5:42953683-42953705 TATTGGGCTTGGAGAGGTAGCGG - Intergenic
989743568 5:44800494-44800516 TCCAGGGCTTTGAGAGGTCGAGG + Intergenic
992596550 5:78353169-78353191 TAGAGGGCTTTGAGTGGATGAGG + Intergenic
993002839 5:82399483-82399505 CAAAGGGATGTGAGAAGAAGGGG + Intergenic
993488720 5:88519211-88519233 TAAATGGCTTTGACAAGTAGGGG - Intergenic
994816237 5:104591640-104591662 GAAAGGGGCTTCAGAGGAAGGGG - Intergenic
994938315 5:106285577-106285599 AAAAGTGCTTTCAAAGGAAGTGG - Intergenic
995128670 5:108606939-108606961 TAAAGGGATTTGAGTGGGAAAGG - Intergenic
995353036 5:111203964-111203986 TAAAGGGCTTTGAAATAAAATGG - Intergenic
996425818 5:123312840-123312862 GACAGAGCTTTGAGAGGGAGGGG - Intergenic
996520396 5:124419770-124419792 TTGAGGGCTTTGAGAGCAACTGG + Intergenic
996720311 5:126623650-126623672 TAAAGATCTTTGAAATGAAGAGG - Intronic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997131686 5:131283332-131283354 TAAACGGCTATCAGAGGATGTGG - Intronic
997477535 5:134153609-134153631 TAAAGGGTGCTGAGAGCAAGAGG + Exonic
998124301 5:139605991-139606013 CACAGGGCTTTGGGAGGCAGAGG - Intronic
998296092 5:140969983-140970005 TAGAGGGCTGTCAGAGGGAGTGG + Intronic
998924105 5:147103633-147103655 CAAAGGCTTTTGAAAGGAAGTGG - Intergenic
1001966549 5:175913891-175913913 TCAAAGGCTTTCAGAGTAAGGGG + Intergenic
1002250398 5:177925313-177925335 TCAAAGGCTTTCAGAGTAAGGGG - Intergenic
1002360830 5:178669524-178669546 ATAAGGGCTTAGAGAAGAAGAGG + Intergenic
1003283901 6:4717444-4717466 TAAAGGCCTTTGGGAGGCTGAGG + Intronic
1003487459 6:6591931-6591953 CAAAGGGCTGAAAGAGGAAGTGG + Intronic
1004430805 6:15541047-15541069 AAAAGGGCTCTGAAATGAAGTGG - Intronic
1005029613 6:21496495-21496517 TAAAGGGCTTTAACTGGAACTGG - Intergenic
1005407915 6:25511457-25511479 AATAGGACTTTGAGAGGAAACGG - Intronic
1005986924 6:30881418-30881440 TAAAAGGCTGAGAAAGGAAGAGG - Intronic
1005999413 6:30953769-30953791 CTAAGGGATTTGGGAGGAAGAGG - Exonic
1006778506 6:36615608-36615630 TTAAGTGCTTTGTGAGGAAGGGG + Intergenic
1009340061 6:62542352-62542374 TCAAGGGATGTGAGAGGAATGGG - Intergenic
1009723285 6:67504578-67504600 TAAAGGGAATTGAAAGGATGTGG + Intergenic
1009723663 6:67507891-67507913 TAAAGGGATTTGAGAGGATGTGG + Intergenic
1010016581 6:71111146-71111168 GAAAGGGATTTCAGAAGAAGAGG - Intergenic
1010102977 6:72131704-72131726 GACAGGGCTTTGAGAGCAACTGG + Intronic
1010422437 6:75690518-75690540 TACTGGGATTTGAGGGGAAGGGG + Intronic
1010626919 6:78148428-78148450 TAAAGGCATTTGAGAGGGATTGG - Intergenic
1014629904 6:123775399-123775421 TAAAGAGCCTTCAGTGGAAGCGG - Intergenic
1015799016 6:137042345-137042367 TGAAGGGCTTTGAGCAGAGGAGG + Intronic
1016734190 6:147458457-147458479 AAAAGGAGTTTTAGAGGAAGGGG - Intergenic
1016757679 6:147704562-147704584 AAAAGGGCTGTGACAGGTAGTGG + Intronic
1018867774 6:167759093-167759115 TAAAGAGCTTTGTGAGGATTTGG + Intergenic
1018961884 6:168455113-168455135 TGAAGGGCCTTGGGAGGAACTGG + Intronic
1018966972 6:168497048-168497070 TCACAGGCTTTGAGAGGAAGGGG - Intronic
1019800179 7:3082689-3082711 ACAGGGGCTTTGGGAGGAAGTGG - Intergenic
1021220093 7:17965602-17965624 TAAGGGGCTTTCTGAGGAAAAGG - Intergenic
1023137347 7:37065535-37065557 TTAAGGGCTTCTAGAGGAAGAGG - Intronic
1023223298 7:37943319-37943341 TAACAGACTTTGAGAGGAATTGG - Intronic
1023775539 7:43602626-43602648 TAAACGGCTCTGAGAGGAGGAGG - Intronic
1024393135 7:48837750-48837772 TACAGAGATTTCAGAGGAAGGGG - Intergenic
1024532253 7:50403100-50403122 TAAAAGGCAGTGAGAGGAAAGGG - Intronic
1026012465 7:66647395-66647417 TATAGCACTTTGAGAGGCAGAGG + Intronic
1026792534 7:73343895-73343917 AAAAGGGGCTTGAGAGGAGGAGG + Intronic
1026827377 7:73593064-73593086 TGGAGGGCTTTGAGTGGAGGTGG - Intergenic
1026936465 7:74259296-74259318 GGAAGGGCTTTGATGGGAAGGGG + Intergenic
1028978991 7:96945952-96945974 TAACGGGCTTTGTGGGGAACAGG - Intergenic
1029179029 7:98685967-98685989 TGAAGGACCTTGAGAGGAGGTGG + Intergenic
1029467356 7:100734637-100734659 AAAAAGACCTTGAGAGGAAGGGG + Intronic
1030019996 7:105264166-105264188 TAAAGGGCATTCAGTGGAAAAGG - Intronic
1030266788 7:107629620-107629642 TAAATGACTTTCAGAGAAAGTGG + Intergenic
1030307448 7:108033354-108033376 TAAAGGGGTTGGATAGGAAGAGG - Intronic
1032989031 7:137370446-137370468 ATAAGGTCTTTGAGAGGAAAAGG - Intergenic
1035667281 8:1388536-1388558 GTCAGGGCTTTGAGAGGCAGAGG + Intergenic
1037025861 8:14036643-14036665 GAAAGGTCTATTAGAGGAAGTGG + Intergenic
1037880992 8:22573380-22573402 ACAAGCGCTTTGAGAGGAATGGG + Intronic
1038459534 8:27704193-27704215 TCCAGTGCTTTGAGAGGCAGAGG + Intergenic
1038523792 8:28256359-28256381 AAAAGGGGTTTGGGAGAAAGAGG + Intergenic
1038969405 8:32615671-32615693 AAAATGGCTTTGAAGGGAAGAGG - Intronic
1039422537 8:37455028-37455050 GAAAGGGCTTTGTGGGGAGGGGG + Intergenic
1040584638 8:48727455-48727477 GACAGGGCTCTGTGAGGAAGTGG + Intronic
1040991807 8:53359988-53360010 TGGAGGGGTTTGAGAGGAAATGG - Intergenic
1041119769 8:54574394-54574416 GAAAGGTCTGTTAGAGGAAGGGG + Intergenic
1044323984 8:90839517-90839539 TATAGTGCTTTGAGAGGAACAGG + Intronic
1044338978 8:91025150-91025172 TAAAGAGAATTAAGAGGAAGAGG + Intronic
1044607957 8:94063500-94063522 AAAAGGGTTTGGAGAGGAAGAGG - Intergenic
1045174510 8:99707304-99707326 TATAGGACTTTGAGAGGATTAGG + Intronic
1045500341 8:102739836-102739858 TAAAGGGCATTTGGAGGTAGAGG + Intergenic
1045548842 8:103152327-103152349 TGAAGGCCTGTGACAGGAAGGGG - Intronic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1046815946 8:118583729-118583751 TAAAAGGCTTTCTGAAGAAGAGG - Intronic
1047739500 8:127795127-127795149 TGAGGGGGTGTGAGAGGAAGCGG - Intergenic
1050169410 9:2799760-2799782 TAAAGGCCTCTTAGAGGAAATGG - Intronic
1050966351 9:11808939-11808961 TAATGGGCTTTAAGATCAAGGGG - Intergenic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1051694135 9:19750347-19750369 AAATGGGTTTGGAGAGGAAGAGG - Intronic
1052092333 9:24344175-24344197 TCAAGCACTTTGAGAGGCAGAGG + Intergenic
1052113335 9:24617423-24617445 TAAATGGCTTTGTGATTAAGTGG + Intergenic
1052411935 9:28132633-28132655 TAAGGGGCTTTGACAGAAAGTGG - Intronic
1052788649 9:32853588-32853610 TAAAAGGCTTTGTAAGGACGAGG + Intergenic
1054704400 9:68448069-68448091 AAAGGGGCTTTGAGGGGAGGAGG + Intronic
1054770546 9:69079268-69079290 TAAAGGAATTTTTGAGGAAGTGG - Intronic
1055527546 9:77150290-77150312 TAAATGTCTTTGAGGGGAAAAGG - Intergenic
1055911290 9:81355232-81355254 TAAAGGGCTTTGCCCGGAAAAGG + Intergenic
1056292396 9:85156932-85156954 TAAAGGGCTGAGGGAGGAAATGG + Intergenic
1056445847 9:86665684-86665706 TAAAGGGTTTTTAGAGGGAGTGG - Intergenic
1057255993 9:93547482-93547504 TAAAGGGCAGTGAGAGGAGATGG + Intronic
1058038431 9:100278401-100278423 TATAGGGCTATGGGAGGATGTGG - Intronic
1059343507 9:113612932-113612954 GAAGGGGCTTTGTGAGGAAGAGG + Intergenic
1061251462 9:129428837-129428859 CACAGGGCTTTGTGAGGACGGGG - Intergenic
1061603700 9:131691641-131691663 GAAAGGACTTTGACAAGAAGAGG + Intronic
1186927992 X:14356424-14356446 TAAAGGGGTTAAAGAGGAGGTGG + Intergenic
1187098277 X:16168653-16168675 TAAACAGCCTTGAGAGGATGTGG + Intronic
1188392848 X:29642355-29642377 TCTAGTTCTTTGAGAGGAAGAGG + Intronic
1190299361 X:49047590-49047612 TGAAGGTCTTTGGGAGGAATGGG + Intergenic
1190435402 X:50419518-50419540 TAAAGGTCTTAGAGATAAAGGGG - Intronic
1190761125 X:53439191-53439213 TGAAGGGGTTTGAAAGCAAGTGG - Intergenic
1190803277 X:53812795-53812817 GACAGAGCTTTCAGAGGAAGGGG - Intergenic
1191209559 X:57871162-57871184 GACAGAGCTTTCAGAGGAAGGGG - Intergenic
1192573023 X:72221928-72221950 AAAAGGGGTTTCAGAGGAAGGGG - Intronic
1193695572 X:84703637-84703659 TAAAGGGCTTTAAGTGGGTGGGG + Intergenic
1194876467 X:99194918-99194940 TACAGGTCTTTGTGAGGATGTGG - Intergenic
1195079360 X:101356322-101356344 TAAAGGGGCTGGGGAGGAAGGGG + Intronic
1195450322 X:105004291-105004313 TAAAATGCTTTGACAGGAAGAGG + Intronic
1195691006 X:107625501-107625523 CAAAGGGATGTGAGAGAAAGTGG + Intergenic
1197826515 X:130596107-130596129 CAAAGAGCCTGGAGAGGAAGAGG + Intergenic
1199089737 X:143677737-143677759 GAGATGGCTTTGAGAGGATGCGG - Intergenic
1201438001 Y:13980095-13980117 TGAAGGGCTTTGGGGGCAAGGGG - Intergenic