ID: 1051227799

View in Genome Browser
Species Human (GRCh38)
Location 9:14920950-14920972
Sequence TTTCCCAGTCAGTCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051227799_1051227803 14 Left 1051227799 9:14920950-14920972 CCAGGATGTGACTGACTGGGAAA No data
Right 1051227803 9:14920987-14921009 GCATGTTCAGTGAAGGAGCCAGG 0: 4
1: 1
2: 3
3: 11
4: 175
1051227799_1051227801 -8 Left 1051227799 9:14920950-14920972 CCAGGATGTGACTGACTGGGAAA No data
Right 1051227801 9:14920965-14920987 CTGGGAAAAAACGTTGGACTAGG No data
1051227799_1051227802 7 Left 1051227799 9:14920950-14920972 CCAGGATGTGACTGACTGGGAAA No data
Right 1051227802 9:14920980-14921002 GGACTAGGCATGTTCAGTGAAGG 0: 4
1: 1
2: 1
3: 14
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051227799 Original CRISPR TTTCCCAGTCAGTCACATCC TGG (reversed) Intergenic
No off target data available for this crispr