ID: 1051233871

View in Genome Browser
Species Human (GRCh38)
Location 9:14978588-14978610
Sequence CAGGCTGGCCTGAGAGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051233871_1051233883 23 Left 1051233871 9:14978588-14978610 CCCTTAACTCTCAGGCCAGCCTG No data
Right 1051233883 9:14978634-14978656 CAACGCCTCTCAGCTCGGCCTGG No data
1051233871_1051233879 18 Left 1051233871 9:14978588-14978610 CCCTTAACTCTCAGGCCAGCCTG No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051233871 Original CRISPR CAGGCTGGCCTGAGAGTTAA GGG (reversed) Intergenic
No off target data available for this crispr