ID: 1051233879

View in Genome Browser
Species Human (GRCh38)
Location 9:14978629-14978651
Sequence CACCCCAACGCCTCTCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051233875_1051233879 -6 Left 1051233875 9:14978612-14978634 CCTCCTCTCCCTGTGTGCACCCC No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233872_1051233879 17 Left 1051233872 9:14978589-14978611 CCTTAACTCTCAGGCCAGCCTGT No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233873_1051233879 3 Left 1051233873 9:14978603-14978625 CCAGCCTGTCCTCCTCTCCCTGT No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233871_1051233879 18 Left 1051233871 9:14978588-14978610 CCCTTAACTCTCAGGCCAGCCTG No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233876_1051233879 -9 Left 1051233876 9:14978615-14978637 CCTCTCCCTGTGTGCACCCCAAC No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233874_1051233879 -1 Left 1051233874 9:14978607-14978629 CCTGTCCTCCTCTCCCTGTGTGC No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data
1051233870_1051233879 24 Left 1051233870 9:14978582-14978604 CCGGCGCCCTTAACTCTCAGGCC No data
Right 1051233879 9:14978629-14978651 CACCCCAACGCCTCTCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051233879 Original CRISPR CACCCCAACGCCTCTCAGCT CGG Intergenic
No off target data available for this crispr