ID: 1051235085

View in Genome Browser
Species Human (GRCh38)
Location 9:14991101-14991123
Sequence CCTGCAAACCAGGATCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051235085_1051235088 -10 Left 1051235085 9:14991101-14991123 CCTCGGTGATCCTGGTTTGCAGG No data
Right 1051235088 9:14991114-14991136 GGTTTGCAGGACTCCAAACTCGG No data
1051235085_1051235089 -5 Left 1051235085 9:14991101-14991123 CCTCGGTGATCCTGGTTTGCAGG No data
Right 1051235089 9:14991119-14991141 GCAGGACTCCAAACTCGGACTGG No data
1051235085_1051235092 22 Left 1051235085 9:14991101-14991123 CCTCGGTGATCCTGGTTTGCAGG No data
Right 1051235092 9:14991146-14991168 TACACCATCTCCAGTTATCAGGG No data
1051235085_1051235091 21 Left 1051235085 9:14991101-14991123 CCTCGGTGATCCTGGTTTGCAGG No data
Right 1051235091 9:14991145-14991167 CTACACCATCTCCAGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051235085 Original CRISPR CCTGCAAACCAGGATCACCG AGG (reversed) Intergenic
No off target data available for this crispr