ID: 1051238942 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:15031469-15031491 |
| Sequence | TGATGTTCACTTTATTGTGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051238940_1051238942 | 6 | Left | 1051238940 | 9:15031440-15031462 | CCAAGACATTCATGGGGCTCGCT | No data | ||
| Right | 1051238942 | 9:15031469-15031491 | TGATGTTCACTTTATTGTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051238942 | Original CRISPR | TGATGTTCACTTTATTGTGG TGG | Intergenic | ||