ID: 1051238942

View in Genome Browser
Species Human (GRCh38)
Location 9:15031469-15031491
Sequence TGATGTTCACTTTATTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051238940_1051238942 6 Left 1051238940 9:15031440-15031462 CCAAGACATTCATGGGGCTCGCT No data
Right 1051238942 9:15031469-15031491 TGATGTTCACTTTATTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051238942 Original CRISPR TGATGTTCACTTTATTGTGG TGG Intergenic