ID: 1051243989

View in Genome Browser
Species Human (GRCh38)
Location 9:15090762-15090784
Sequence TTGGGCAGTGACTTGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051243989_1051243995 24 Left 1051243989 9:15090762-15090784 CCAGCAACCAAGTCACTGCCCAA No data
Right 1051243995 9:15090809-15090831 CCTGAGTCCTGAGAATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051243989 Original CRISPR TTGGGCAGTGACTTGGTTGC TGG (reversed) Intergenic
No off target data available for this crispr