ID: 1051245835

View in Genome Browser
Species Human (GRCh38)
Location 9:15110063-15110085
Sequence TAGACATTGTATATAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051245833_1051245835 -5 Left 1051245833 9:15110045-15110067 CCTTGCCAGAAAAATACATAGAC No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245831_1051245835 1 Left 1051245831 9:15110039-15110061 CCCTAACCTTGCCAGAAAAATAC No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245829_1051245835 18 Left 1051245829 9:15110022-15110044 CCTAATGAAAGTTATGCCCCTAA No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245834_1051245835 -10 Left 1051245834 9:15110050-15110072 CCAGAAAAATACATAGACATTGT No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245832_1051245835 0 Left 1051245832 9:15110040-15110062 CCTAACCTTGCCAGAAAAATACA No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245828_1051245835 28 Left 1051245828 9:15110012-15110034 CCTTCAAGAACCTAATGAAAGTT No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data
1051245830_1051245835 2 Left 1051245830 9:15110038-15110060 CCCCTAACCTTGCCAGAAAAATA No data
Right 1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051245835 Original CRISPR TAGACATTGTATATAATTTC AGG Intergenic
No off target data available for this crispr