ID: 1051250050

View in Genome Browser
Species Human (GRCh38)
Location 9:15150459-15150481
Sequence AGGGAGAAGGTGAGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051250046_1051250050 -7 Left 1051250046 9:15150443-15150465 CCCAGTTGGCAGGAATAGGGAGA No data
Right 1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG No data
1051250047_1051250050 -8 Left 1051250047 9:15150444-15150466 CCAGTTGGCAGGAATAGGGAGAA No data
Right 1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051250050 Original CRISPR AGGGAGAAGGTGAGTGTGGC TGG Intergenic
No off target data available for this crispr