ID: 1051260230

View in Genome Browser
Species Human (GRCh38)
Location 9:15256750-15256772
Sequence AACCCTGTGCTGCTCCGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051260230_1051260237 29 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260237 9:15256802-15256824 TGGCTGGAGGGTCATGCATGAGG No data
1051260230_1051260232 2 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260232 9:15256775-15256797 CTCTCACAAAAAACTGTATAAGG No data
1051260230_1051260235 16 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260235 9:15256789-15256811 TGTATAAGGCTTGTGGCTGGAGG No data
1051260230_1051260233 9 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260233 9:15256782-15256804 AAAAAACTGTATAAGGCTTGTGG No data
1051260230_1051260234 13 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260234 9:15256786-15256808 AACTGTATAAGGCTTGTGGCTGG No data
1051260230_1051260236 17 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260236 9:15256790-15256812 GTATAAGGCTTGTGGCTGGAGGG No data
1051260230_1051260238 30 Left 1051260230 9:15256750-15256772 CCAATCCGGAGCAGCACAGGGTT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1051260238 9:15256803-15256825 GGCTGGAGGGTCATGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051260230 Original CRISPR AACCCTGTGCTGCTCCGGAT TGG (reversed) Intronic
903658484 1:24963162-24963184 AAGGCTGTGCTGCTGCAGATGGG - Intronic
906242228 1:44249104-44249126 AATCCTGGGCTTCTCCGGGTAGG + Intronic
910590523 1:88924744-88924766 CACCCATTGCTGCTCCCGATTGG + Intergenic
912463387 1:109852498-109852520 CACCCATTGCTGCTCCTGATCGG - Intergenic
912490041 1:110057760-110057782 GACCCTCTGCAGCTCCAGATGGG - Intronic
913099282 1:115548145-115548167 AACACTGTGGTCCTCCAGATAGG + Intergenic
914679636 1:149929972-149929994 CACCCTGTCCTGATCCAGATTGG - Intronic
915624993 1:157109015-157109037 AACCCTGAGCTGATCGAGATGGG + Intergenic
917458171 1:175203679-175203701 AATCCAGTGCTGCTCCTGCTGGG + Intergenic
922795212 1:228336376-228336398 AAGGCTGTGCTGCTCAGGAGGGG - Intronic
1063499810 10:6543300-6543322 AAGCCTGTGCTGCTCCGCCAGGG - Intronic
1073914548 10:108387039-108387061 ACCCCAGTGCAGCTCCAGATGGG + Intergenic
1083604518 11:63970045-63970067 AACCCTGTGCCCCTAGGGATCGG + Intergenic
1091544782 12:1494293-1494315 AGCCCTGGGCTGCTCAGGAGGGG + Exonic
1092469907 12:8768229-8768251 CACCCATTGCTGCTCCTGATCGG - Intronic
1092743313 12:11650195-11650217 AACCCTGAGCTGCACCGGCCAGG + Intronic
1095829605 12:46570038-46570060 AAAGCTGCACTGCTCCGGATTGG - Intergenic
1096351217 12:50902763-50902785 CACCCATTGCTGCTCCGGATCGG - Intergenic
1097376728 12:58852130-58852152 CACCCATTGCTGCTCCGGATTGG - Intergenic
1099639976 12:85273978-85274000 AAATCTGTGTTGCTCGGGATAGG + Intergenic
1101714500 12:107298657-107298679 AACCCTGTGCTGCTAGGAGTAGG - Intergenic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1103804012 12:123558476-123558498 CACCCACTGCTGCTCTGGATGGG + Intergenic
1103845438 12:123898895-123898917 AGCCCTGTCCTGCTCGGGATGGG - Intronic
1103872323 12:124100744-124100766 CACCCATTGCTGCTCCCGATGGG - Intronic
1111090500 13:83439682-83439704 CACCCATTGCTGCTCCTGATTGG + Intergenic
1114653274 14:24300067-24300089 AACCCTGGCCGCCTCCGGATGGG + Exonic
1120341453 14:83225792-83225814 CACCCGCTGCTGCTCCTGATGGG + Intergenic
1122918099 14:104868042-104868064 ACCCATGAGCTGCTCCTGATGGG + Intronic
1129659352 15:77544319-77544341 CAGTCTGTGCTGCTCTGGATGGG - Intergenic
1141769032 16:86077712-86077734 GACCCGGTGCTGCCCCGGACTGG - Intergenic
1146234970 17:31150734-31150756 AACACAGTGATGCTCCGGCTGGG + Intronic
1153839138 18:8990489-8990511 GACCCTGTGCTGCTCCGTCCGGG - Intergenic
1157782187 18:50449416-50449438 CACCCATTGCTGCTCCTGATCGG - Intergenic
1159462675 18:68740674-68740696 AACCCAGTGCTGCCTCGGACGGG + Intronic
1163627059 19:18396334-18396356 AACCCTGGGCTGCTCAGGATGGG - Exonic
1165468636 19:35990122-35990144 AACCCTGTGATGCCCTGGAGGGG + Intergenic
929565085 2:42978996-42979018 GGCCATGTGCTGCTCCGGGTGGG - Intergenic
930377984 2:50591724-50591746 AACCATGTGCTGTCCCAGATAGG - Intronic
931989539 2:67776250-67776272 AAAGCAGTGCTTCTCCGGATGGG - Intergenic
941395552 2:164968813-164968835 CACCCAATGCTGCTCCCGATCGG - Intergenic
941932379 2:170955048-170955070 AAACCTGTACTGCTAGGGATTGG + Intronic
946496545 2:220201441-220201463 ACCACTGTGCTGCTCCAGAGTGG + Intergenic
1176196835 20:63840789-63840811 AACCCTGTCCAGCTCAGGCTGGG - Intergenic
1179335414 21:40447090-40447112 ACCCCTGTGCTGCTAGGGAAGGG - Intronic
1180791236 22:18576847-18576869 AGCCCAGTGCTGAGCCGGATGGG - Intergenic
1181230502 22:21418467-21418489 AGCCCAGTGCTGAGCCGGATGGG + Intronic
1181248148 22:21516402-21516424 AGCCCAGTGCTGAGCCGGATGGG - Intergenic
1183976620 22:41515948-41515970 TACCCTGTGCTGGGCCTGATGGG + Intronic
950566730 3:13773636-13773658 AGCCCTGTGCTGCTGTGGCTGGG + Intergenic
954640943 3:52097366-52097388 ACCCCTGGGCTGCTTCAGATAGG + Intronic
961556773 3:127701501-127701523 AACCCTGTGGTGCTTCCCATGGG + Intronic
971097417 4:23423687-23423709 AACCCTGTGCAGCCCAGGCTTGG + Intergenic
972732403 4:41807929-41807951 AACCCTGAGTTGCTACGAATGGG + Intergenic
975608724 4:76182607-76182629 ATCCCTGTGCTGCTATGGTTGGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978527659 4:109681700-109681722 ACCCCTTTGCCGCTCCAGATCGG - Intronic
981527946 4:145725413-145725435 AACCCAGTGATGCTGCGTATAGG + Intronic
987855146 5:23411397-23411419 CGCCCATTGCTGCTCCGGATAGG + Intergenic
999573512 5:152947323-152947345 GACCCTGTGCTGTTCAGTATAGG - Intergenic
1001425284 5:171618545-171618567 GACCCTGAGCTGCTGCAGATAGG - Intergenic
1001707674 5:173753571-173753593 AAACCTGAGCTGCTCCTGAGAGG + Intergenic
1007594022 6:43040422-43040444 AACCCTGTGCTCCTTCAGGTGGG - Exonic
1015922830 6:138282375-138282397 AGCCCTGTGCTGTTCCTGCTGGG - Intronic
1027868349 7:83674978-83675000 CACCCATTGCTGCTCCAGATTGG - Intergenic
1028743914 7:94306556-94306578 AACAATGTGCTGCCCTGGATGGG - Intergenic
1029966438 7:104745697-104745719 AACCCAGGGCAGCTCTGGATTGG - Intronic
1030063044 7:105638441-105638463 AATCCTGTGCCGGCCCGGATTGG + Exonic
1031472014 7:122177287-122177309 CACCCATTGCTGCTCCTGATCGG + Intergenic
1032504198 7:132423659-132423681 AACCCTGTGCTGTTGTGGAAGGG - Intronic
1032795172 7:135270702-135270724 GGCCGTGTGCTGCTCCTGATGGG - Intergenic
1034161886 7:149000241-149000263 ATCCCTTTGCTGCACCGGGTAGG + Intergenic
1042788562 8:72577752-72577774 AACCCGGTGCAGCTCCAGATGGG + Intronic
1048100242 8:131343134-131343156 CACCCATTGCTGCTCCTGATCGG - Intergenic
1049369521 8:142257228-142257250 AACCCCGGGCTGCTCCAGTTGGG - Intronic
1051260230 9:15256750-15256772 AACCCTGTGCTGCTCCGGATTGG - Intronic
1055842337 9:80519851-80519873 GATTCTGTGCTGCTCCGGGTAGG + Intergenic
1060751794 9:126174357-126174379 ATCTCTGTGCTGCTCCAGGTGGG + Intergenic
1061885971 9:133591302-133591324 AACCAGGTGCTGTTCCGGATGGG + Intergenic
1062027558 9:134347536-134347558 AGCCTTGTGCTCCTCCGGACAGG - Intronic
1193224078 X:78961022-78961044 AAGTCTGTGCTTCTCAGGATGGG - Exonic