ID: 1051261845

View in Genome Browser
Species Human (GRCh38)
Location 9:15272339-15272361
Sequence TTCCCTTAGCTCCCCAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051261839_1051261845 19 Left 1051261839 9:15272297-15272319 CCATACTCACCATAAATTTCCTA 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG No data
1051261840_1051261845 10 Left 1051261840 9:15272306-15272328 CCATAAATTTCCTAGTGCTCCTC 0: 1
1: 0
2: 0
3: 24
4: 196
Right 1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG No data
1051261843_1051261845 -9 Left 1051261843 9:15272325-15272347 CCTCCAGTGTTGGTTTCCCTTAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG No data
1051261842_1051261845 0 Left 1051261842 9:15272316-15272338 CCTAGTGCTCCTCCAGTGTTGGT 0: 1
1: 0
2: 0
3: 7
4: 180
Right 1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051261845 Original CRISPR TTCCCTTAGCTCCCCAGTAC TGG Intronic
No off target data available for this crispr