ID: 1051262603

View in Genome Browser
Species Human (GRCh38)
Location 9:15279487-15279509
Sequence GAGCCAGTGGGTGGTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051262603_1051262608 7 Left 1051262603 9:15279487-15279509 CCAGTTTCACCACCCACTGGCTC 0: 1
1: 0
2: 3
3: 21
4: 308
Right 1051262608 9:15279517-15279539 TTGAGCAAGCTATTTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051262603 Original CRISPR GAGCCAGTGGGTGGTGAAAC TGG (reversed) Intronic
900530060 1:3148708-3148730 AAGCCAAAGGGTGGTGAATCTGG + Intronic
902584455 1:17429821-17429843 GAGCCAATGGTGAGTGAAACAGG + Intronic
902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG + Intergenic
902724002 1:18323283-18323305 GAGGCCCTGGGTGGTGAAGCTGG - Intronic
902782997 1:18716596-18716618 GAGCAAGGGGGTGGTGGCACAGG - Intronic
902881863 1:19376874-19376896 GAGCTAGTAAGTGGTGGAACTGG - Intronic
902914092 1:19625545-19625567 GAGCCAGGGAGTGGTGGAAAAGG - Intronic
903166455 1:21523803-21523825 GAGCTAGTGGGTGGTTGAGCTGG + Intronic
904128385 1:28258768-28258790 TAGGAAGTGGGTGGTGAAAGAGG + Intergenic
904235586 1:29114664-29114686 TAGCTAGTAGGTAGTGAAACAGG - Intronic
904316410 1:29668954-29668976 GAGCCAGCGCTTGGTGGAACTGG + Intergenic
904465022 1:30702485-30702507 GTGCCAATGGGTGGTGAGATGGG - Intergenic
904681670 1:32233662-32233684 CAGCAGGTGAGTGGTGAAACTGG + Intergenic
904913027 1:33949609-33949631 GAGCCACTGGCTGGTGAGCCAGG - Intronic
906699227 1:47845528-47845550 CAGCCAGTAAATGGTGAAACTGG + Intronic
907779182 1:57549680-57549702 GAGACATTGGGTTGTGCAACAGG + Intronic
907952452 1:59196793-59196815 GAACCAGTGGGTGGAAACACAGG - Intergenic
908568721 1:65386313-65386335 GTGCCAGTGGGTGGTCATAGGGG + Intronic
912954540 1:114145388-114145410 CAACTAGTGGGTGGTGAAACTGG + Intronic
917621184 1:176797746-176797768 GAGCAAGAGGGCTGTGAAACAGG - Intronic
918192449 1:182188710-182188732 GAGGCAGTGGTTGGTGTAATTGG + Intergenic
922594150 1:226800820-226800842 GAGCCAGTGGGGGATCAGACAGG - Intergenic
924721920 1:246631388-246631410 CAGCCGGTGGTTTGTGAAACAGG + Intronic
1063680947 10:8187463-8187485 GAGCCAGTAGGTTGAGATACAGG - Intergenic
1064098846 10:12445613-12445635 AAGTCAGTGGGTGGGGAAAACGG - Intronic
1065888306 10:30098318-30098340 GAGCCAGCTGGGGGAGAAACAGG - Intronic
1067202237 10:44183244-44183266 GAACCAGAGGGTGTTTAAACAGG - Intergenic
1069416624 10:68206381-68206403 GAGCCAGGGGGTGGATGAACTGG - Intronic
1071335778 10:84599450-84599472 CAGCCAGTAGGTGGTGAATCTGG + Intergenic
1071411504 10:85401463-85401485 GAGCCAGGGGAAGGTGAAGCAGG + Intergenic
1073970364 10:109040938-109040960 GTGCCAGTGAGAGGTGAAGCCGG + Intergenic
1074414966 10:113259977-113259999 GTGCCAATGGGCTGTGAAACGGG + Intergenic
1074692404 10:116018257-116018279 GAGGCAGTGGGAGGTAAAAATGG - Intergenic
1074849975 10:117432018-117432040 GAGCCAGTGAGTGGTGGGATTGG + Intergenic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1076510757 10:131012256-131012278 CAGCCAGAGGGTGGTCCAACTGG + Intergenic
1077770254 11:5210449-5210471 GAGCAAGTGGATGGGGAAAAGGG + Intergenic
1077920252 11:6636670-6636692 GAAGCAGTGGGTGGAGAAGCAGG - Intronic
1077923282 11:6656523-6656545 GAGACAGCGGGTAGTGAAAAGGG - Intergenic
1078362410 11:10679513-10679535 GAGCTAATGGGTGGCCAAACAGG + Intronic
1078448500 11:11422937-11422959 GTAGCAGTGGGTGGTGAAAGAGG + Intronic
1078519452 11:12051522-12051544 CAGCTAGTGAGTGGTGAAGCTGG - Intergenic
1079219120 11:18543851-18543873 GAGCAAGTGGCTGGAGAAAAAGG + Intronic
1079985465 11:27196210-27196232 GAGCATGTGGGTGGTGAGATAGG - Intergenic
1080719774 11:34837665-34837687 GGGCTAGTGGGTGGTGCTACTGG + Intergenic
1081447562 11:43145479-43145501 GGGCCAGTGGGTTGTGAACAGGG + Intergenic
1081615932 11:44591216-44591238 GAGCCCATGGGTGGTGTAAGGGG + Intronic
1081969526 11:47187923-47187945 GAGAGAGTGGGTGTTGAAATTGG - Intergenic
1082563412 11:54646361-54646383 GAGGCAGAGGGTGGGGAAAATGG - Intergenic
1083774674 11:64888626-64888648 GAGCCAGTGAGTGGGGTAATGGG + Intergenic
1084333756 11:68445436-68445458 CAGCCAGAAGGTGGTAAAACAGG + Intronic
1085750985 11:79160986-79161008 TAGCCAGTAGGTGGTGGAAGAGG - Intronic
1087404840 11:97717815-97717837 GTGTCAGTGGGAGGTGAAGCCGG - Intergenic
1087962232 11:104366405-104366427 GTGCCAGTGAGAGGTGAAGCTGG - Intergenic
1089128096 11:116191448-116191470 AGCCCAGTGGCTGGTGAAACAGG + Intergenic
1090247304 11:125225554-125225576 GAGGCAGTGGGTGGGGGAGCTGG - Intronic
1090278178 11:125434002-125434024 AAGCCAGTGGTTGGTTACACAGG + Intergenic
1090666401 11:128917701-128917723 GAGCCAGTTGGCCCTGAAACAGG + Exonic
1091418019 12:307525-307547 GAGCCAGCGTATGGTGGAACAGG - Exonic
1091594359 12:1865725-1865747 GAGCCGGTGTGTGGGGAACCGGG + Intronic
1092845006 12:12576286-12576308 CAGCCAGTGTGTGGTGAAGCTGG - Intergenic
1093449601 12:19299951-19299973 GAGTCACTGGCTGGAGAAACGGG - Intronic
1093800282 12:23364227-23364249 CAGCCTCTGGGTGGTGACACAGG - Intergenic
1097547604 12:61023717-61023739 GTGCCAGTGAGAGGTGAAGCCGG + Intergenic
1099437240 12:82659389-82659411 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
1099864894 12:88267706-88267728 TAGTCACTGTGTGGTGAAACTGG + Intergenic
1101170073 12:102082619-102082641 CAGCTAGTAAGTGGTGAAACTGG + Intronic
1101731055 12:107426956-107426978 GGGGCAGTGGGGGGTGAAAATGG - Intronic
1102547393 12:113666584-113666606 GATCTAGTGGGTGATGAACCAGG + Intergenic
1103001698 12:117389770-117389792 CAGCCAGTAGGTGGTGGAGCTGG + Intronic
1103450247 12:121023845-121023867 GAGCCCATGGGTGGTGCAGCTGG + Intronic
1103555824 12:121765907-121765929 GAGGCGGTGGGAGGTGAGACTGG + Intronic
1103937497 12:124484348-124484370 GAGCCAGTCGCTGGGGAAACTGG - Intronic
1103970588 12:124668498-124668520 CAGCCAGTGAGTGGTGAAGCTGG + Intergenic
1104450811 12:128866977-128866999 GAGACAGTGTGTGGTGGAAGGGG - Intronic
1105237140 13:18567807-18567829 GCGCCAGTGAGAGGTGAAGCCGG - Intergenic
1111547656 13:89763828-89763850 GAGCTGGTGGGTGGGGAAAATGG + Intergenic
1111891844 13:94092289-94092311 GGGCAAGTGGGTGGGGAAAATGG - Intronic
1113519379 13:110928584-110928606 TAGCCAGGGTGTGGGGAAACAGG - Intergenic
1113810759 13:113141114-113141136 GTGCCAGGGGGTGGGGACACAGG + Intronic
1117026433 14:51625132-51625154 GAGCCAGAAGGGAGTGAAACAGG + Intronic
1117098269 14:52318996-52319018 CAGCTAATGGGTGGTGGAACTGG + Intronic
1118350987 14:64972321-64972343 GAGGCGGTGGGAGGAGAAACCGG + Intronic
1120144073 14:80960361-80960383 GAGCACGTGGGTGTTGAAGCAGG - Intronic
1120733246 14:88025772-88025794 GAGCCAGAGGGAGGTGAGAGAGG - Intergenic
1121315864 14:92960712-92960734 GAACCACTGGGTGGTTAAAGGGG + Intronic
1121613758 14:95299148-95299170 GAGCCAGCGGGTAGAGAAAAGGG + Intronic
1122131889 14:99609050-99609072 GAGGAAGTGGGTGGTGAACATGG - Intergenic
1122480078 14:102041564-102041586 TGGCCAATGGGTGCTGAAACAGG - Exonic
1122658677 14:103279634-103279656 GAGCCAGCGGATGGTGGACCGGG + Intergenic
1122837554 14:104437512-104437534 CTGCCTGTGGGTGGTGACACTGG + Intergenic
1122895960 14:104757090-104757112 GAGCCCCTGGTTGGTGACACAGG + Intronic
1123552901 15:21399410-21399432 GAGCCCCTGGGTGGTAATACTGG + Intergenic
1123589147 15:21836798-21836820 GAGCCCCTGGGTGGTAATACTGG + Intergenic
1124214492 15:27795425-27795447 GAGCTTGTGGGTGGAGAAACTGG - Intronic
1125538511 15:40456620-40456642 GGGCCAGTGGGTGGGGTCACTGG - Intronic
1128145774 15:65331779-65331801 CAGCAAGTTGGTGGTGGAACTGG + Intronic
1129609292 15:77040043-77040065 GGGCCAGTGGGAGGAGAAAGGGG + Intergenic
1130409583 15:83633617-83633639 GTGCCACTGGGTGGTTGAACTGG - Intergenic
1130608717 15:85341044-85341066 CAGCTAGTGAGTGGTGAACCTGG + Intergenic
1131864056 15:96687971-96687993 AAGCTAGTGAGTGATGAAACGGG - Intergenic
1202961250 15_KI270727v1_random:126630-126652 GAGCCCCTGGGTGGTAATACTGG + Intergenic
1132732074 16:1367518-1367540 GAGCGTGTGGGGGGTGAGACGGG - Intronic
1132891447 16:2206857-2206879 AAGCCAGTGGCTGGTGGAAGGGG - Intronic
1133611944 16:7441832-7441854 CAGCCAGTGGATCGTGAAGCAGG - Intronic
1133905140 16:10015664-10015686 CAGCCAATGGGTGATGAAGCAGG - Intronic
1136031087 16:27503690-27503712 GATCCAGTGTTGGGTGAAACAGG - Intronic
1138386813 16:56641091-56641113 CAGCCAGTAGGTGGTGAAGTGGG - Intronic
1138672863 16:58629646-58629668 GAGCCGGTGGGAGGAGGAACAGG - Intronic
1139088496 16:63617295-63617317 GTGCCACTGGGAGGTGAAGCCGG - Intergenic
1139301089 16:65946040-65946062 GAGCAACTGGGTGGAGAATCTGG - Intergenic
1140972123 16:80023542-80023564 GATACAGTGAGTGGTGAGACAGG + Intergenic
1142587974 17:986506-986528 GAGGCAGTGGGAGGCCAAACAGG + Intergenic
1142604347 17:1073371-1073393 GAGGCAGCGGGTGGGGAAGCAGG + Intronic
1143383373 17:6509961-6509983 GAGCTAGGGGGTGGTAAAAAGGG - Intronic
1143616884 17:8057000-8057022 GAGCCTGCGGGTGGTGTATCAGG + Intergenic
1143750960 17:9027425-9027447 TAGCTACTGGGTGGTGAAGCTGG + Intronic
1143848568 17:9791942-9791964 GAGCCACTGGGAGGTGTGACAGG + Intronic
1144163929 17:12589208-12589230 GAACTAGTGGGTGGAGAAAATGG + Intergenic
1144198233 17:12916264-12916286 GAGGCTGTGGGTGGGGAAGCGGG - Intronic
1144733034 17:17539806-17539828 CAGACAGAGGGTGGTGATACAGG - Intronic
1144967712 17:19088692-19088714 CAGCCAGCGGGTGGTGAGGCAGG + Intergenic
1144980204 17:19163371-19163393 CAGCCAGCGGGTGGTGAGGCAGG - Intergenic
1144988018 17:19214861-19214883 CAGCCAGCGGGTGGTGAGGCAGG + Intergenic
1145176239 17:20702915-20702937 GAGCCCGAGGGTGGTGAGAAGGG - Intergenic
1145286464 17:21509754-21509776 AAGTCAGTGGGTGGTGGAGCTGG + Intergenic
1145391151 17:22456564-22456586 AAGTCAGTGGGTGGTGGAGCTGG - Intergenic
1146688290 17:34856523-34856545 GATCCAGGGGGTGGGGAAAATGG + Intergenic
1146947782 17:36885499-36885521 CGGCCAGTGAGTGGTGAAAATGG + Intergenic
1147896114 17:43752494-43752516 GGTCCAGTGGGTGGGGACACGGG - Intergenic
1148226213 17:45899527-45899549 GAGCCAGTGGGTGGTGGAGCTGG + Intronic
1148695410 17:49555556-49555578 GAGCCAATGGGGCATGAAACAGG + Intergenic
1148908249 17:50925404-50925426 GAGGCAGTGTGAGGTGAAGCTGG - Intergenic
1150616643 17:66777516-66777538 GAGTCAATGGCTGGAGAAACAGG + Intronic
1150696045 17:67406373-67406395 CTGCCAGTGGTTGGGGAAACAGG - Intronic
1152922149 17:83071465-83071487 GAGCCAGAGGGTGGTGAGGAAGG + Intergenic
1154344196 18:13528771-13528793 GAGCCAGTGGGGTGTGCAATGGG - Intronic
1155249300 18:23940024-23940046 CAGCCAGTAAGTGGTGAAGCAGG - Intronic
1156320035 18:36011262-36011284 GAGCTAGTAAGTGGTGAAGCAGG + Intronic
1156520071 18:37714494-37714516 CAGCCAATGGGTGGTGGAGCTGG + Intergenic
1157713140 18:49863732-49863754 GAGCCAGAGGGTGGGGACAGAGG - Intronic
1159314947 18:66760848-66760870 GAGCCAGTGTGGCATGAAACAGG - Intergenic
1162115443 19:8426536-8426558 GATCCAGTGGGTAGTGAAGCAGG + Intronic
1162137666 19:8565698-8565720 GTGTCAGTGGGTGGGGACACGGG + Intronic
1162784322 19:13024803-13024825 GAGCAAGTGGCTGGCGAAGCTGG + Intronic
1164159118 19:22615239-22615261 TAGCCCTTGGGTGGTGAGACAGG + Intergenic
1164705288 19:30314893-30314915 GGGCCAGTGGGTGGGGGATCGGG - Intronic
1166703807 19:44897207-44897229 GAGGCTGTGGGTAGAGAAACTGG + Intronic
1167277840 19:48549759-48549781 GAGCCTGGGGGAGGTGACACTGG + Intergenic
1167413655 19:49359664-49359686 GAGCCAGTGCGTGATGGAGCTGG - Intronic
928793877 2:34992238-34992260 GTGCCAGTGAGAGGTGAAGCTGG + Intergenic
930585157 2:53259667-53259689 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
931058249 2:58497289-58497311 GAGTCAGGGAGTGGTGTAACTGG - Intergenic
931611264 2:64103599-64103621 GAGCCAGTTGGTGCAGAAAAGGG - Intronic
932407237 2:71521688-71521710 GAGCCAGTGTGTGGTGAGGATGG - Intronic
933657612 2:84902705-84902727 CAGCCAGTGGATGGGGAAAGAGG - Intronic
935220844 2:101011175-101011197 GAGCCAGTGGGTGGTAACTGGGG + Intronic
936167026 2:110129738-110129760 CAGACAGTGGTAGGTGAAACTGG + Intronic
936963169 2:118098451-118098473 GAGCCAGTGAGTGGTGTGACTGG + Intronic
937684902 2:124684884-124684906 GAGCTAGTGAGTGGTGAAAGTGG + Intronic
937837086 2:126482688-126482710 GATCCAGTGGGTGGTGTCGCTGG - Intergenic
938106040 2:128530433-128530455 AAAACAGTGGGTGGTGAGACAGG - Intergenic
939047477 2:137266821-137266843 CAGCAAGTGGGTGGTAGAACAGG - Intronic
939829826 2:147058362-147058384 GAGGCAGTGAGTTCTGAAACCGG - Intergenic
941695883 2:168550618-168550640 CAGCCAGTGGCTGGAGAAAAGGG - Intronic
941998758 2:171626358-171626380 GAGCCAGCAGGAGCTGAAACAGG + Intergenic
942536796 2:176973603-176973625 GAGTCAGTGGGTGGGGGAAAAGG + Intergenic
942610688 2:177739274-177739296 AAGCCAGTGAAGGGTGAAACTGG + Intronic
946140896 2:217689879-217689901 GGGCCAGTGGCTGGTGCTACAGG + Intronic
946405550 2:219490228-219490250 GAGCCAGTGAGTGGCGAAGGTGG + Intronic
948252149 2:236537764-236537786 GAGCACGTGGGTGATGAAGCTGG - Intergenic
948684650 2:239662927-239662949 CAGCCAGTTAGTGGTGAAGCTGG + Intergenic
948771492 2:240253376-240253398 GAGCCACTGGGTGCTGGAAGAGG - Intergenic
1169979978 20:11373570-11373592 GATGCAATGGCTGGTGAAACTGG - Intergenic
1170747279 20:19111455-19111477 AAGCCAGTGGGTGGGGAGAGAGG + Intergenic
1171154184 20:22857083-22857105 GGGGCAGTGGGTGGGGAAAAAGG + Intergenic
1172847869 20:37940571-37940593 GAGTCAGTGAGTGGCGGAACTGG - Intronic
1173434961 20:43024118-43024140 GAGCCAGTCTGTGGTGGAGCAGG - Intronic
1174713097 20:52728106-52728128 GTGCCACTGAGAGGTGAAACCGG - Intergenic
1175150201 20:56927969-56927991 GGGCAAGTGTGTGGGGAAACAGG - Intergenic
1176781127 21:13196089-13196111 GCGCCAGTGAGAGGTGAAGCCGG - Intergenic
1176820369 21:13650498-13650520 GAGCCCCTGGGTGGTGATACTGG - Intergenic
1177978817 21:27885241-27885263 GTGCCAGTGAGAGGTGAAACCGG - Intergenic
1179900155 21:44387900-44387922 TGGCCAGTGTGTGGAGAAACTGG + Intronic
1180933026 22:19606188-19606210 CAGCCAGTCGGTGGGGAAGCAGG + Intergenic
1181050729 22:20237187-20237209 GAGCCAGTGGGTGGAGGAACAGG - Intergenic
1181345188 22:22214895-22214917 GAGCCAGGGAGTGGAGAAGCTGG - Intergenic
1181510324 22:23386073-23386095 GTGCCATCTGGTGGTGAAACTGG + Intergenic
1182374153 22:29834169-29834191 CAGTTAGTGGGTGGTGAAGCAGG + Intronic
1183274726 22:36886660-36886682 GAGCCAATAGGTGGAGAAAGAGG - Intergenic
1184175844 22:42788329-42788351 GAGCCAGTGGGTTGGAAGACAGG - Intergenic
949097745 3:106196-106218 GACTCACTGGGTGGTGAAACTGG - Intergenic
950708560 3:14798939-14798961 TAGCCAGTGAGTGGTGGACCGGG + Intergenic
953408113 3:42670118-42670140 ATGGCAGTGGGTGGTGAACCAGG + Intergenic
953582898 3:44173184-44173206 GTGCCAGTGAATGGTGAAGCTGG - Intergenic
954039122 3:47870912-47870934 GAGCCGGGGGGTGGTGGAGCTGG + Exonic
954580941 3:51702604-51702626 GAGACAGTGGCTGGGGAAGCTGG + Intronic
956590294 3:70907494-70907516 GAGGCAATGGGTGGTTAAACTGG + Intergenic
956748367 3:72327400-72327422 GAGGCAATGGGTGGGTAAACTGG - Intergenic
957271022 3:78030120-78030142 GTGCCAGTGAGAGGTGAAGCAGG + Intergenic
959259821 3:104062957-104062979 GAGGGAGTGCGGGGTGAAACTGG + Intergenic
960426627 3:117515739-117515761 GAGCCAGAGTGGGGTGAAAAAGG - Intergenic
961497573 3:127305493-127305515 GAGGCAGTGGGTGATGAAGATGG + Intergenic
962491288 3:135896540-135896562 AAGCCATTGTGTGGAGAAACTGG + Intergenic
962714662 3:138115812-138115834 GAGGCAGGGTGTGGGGAAACCGG - Intronic
964374594 3:156036720-156036742 GAGCGAGTGTGTGCTGAAAGAGG + Intergenic
965139264 3:164814440-164814462 GTGCCAGTGAGAGGTGAAGCTGG + Intergenic
965139874 3:164818664-164818686 GTGCCAGTGAGAGGTGAAGCTGG + Intergenic
968861153 4:3171369-3171391 TAGCCAGGCAGTGGTGAAACAGG + Intronic
969192476 4:5533400-5533422 GAGCCAGTGGGGGGTGGAGTGGG + Intergenic
971426616 4:26522185-26522207 CAGCCAGTGAGTGGTAGAACTGG + Intergenic
972891716 4:43565063-43565085 GAGCCATTGGGTGATGGAAGAGG + Intergenic
976596980 4:86904076-86904098 GTGCCAGTGAGAGGTGAAGCTGG - Intronic
979974046 4:127173822-127173844 TAGCTAGTCAGTGGTGAAACAGG - Intergenic
980119092 4:128709325-128709347 GTGCTAGTGGGTGGTGAGGCAGG + Intergenic
985014800 4:185623043-185623065 GAGGCAGTGGGTGGAGAGGCTGG + Exonic
985612300 5:897148-897170 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612314 5:897214-897236 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612328 5:897280-897302 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612357 5:897412-897434 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612372 5:897478-897500 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612387 5:897544-897566 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612402 5:897610-897632 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612417 5:897676-897698 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612432 5:897742-897764 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612447 5:897808-897830 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612462 5:897874-897896 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612477 5:897940-897962 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612492 5:898006-898028 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612507 5:898072-898094 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612522 5:898138-898160 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612537 5:898204-898226 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612552 5:898270-898292 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612567 5:898336-898358 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612582 5:898402-898424 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612597 5:898468-898490 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612612 5:898534-898556 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612627 5:898600-898622 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612642 5:898666-898688 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612657 5:898732-898754 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612672 5:898798-898820 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612687 5:898864-898886 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612702 5:898930-898952 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612717 5:898996-899018 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612732 5:899062-899084 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612747 5:899128-899150 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612762 5:899194-899216 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612777 5:899260-899282 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612792 5:899326-899348 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612807 5:899392-899414 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612822 5:899458-899480 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612837 5:899524-899546 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612852 5:899590-899612 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612867 5:899656-899678 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612882 5:899722-899744 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612897 5:899788-899810 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612927 5:899916-899938 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612941 5:899982-900004 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985683793 5:1271236-1271258 GAGCCGGTGGGTGCTGAGACAGG + Intronic
991932496 5:71767299-71767321 GAGGCATTGTGTTGTGAAACAGG + Intergenic
993068952 5:83134245-83134267 GTGCCAGTGAGAGGTGAAGCTGG + Intronic
993483649 5:88455035-88455057 GAGACAGTTGGTGGTGACAAGGG - Intergenic
994240096 5:97408657-97408679 GAGCCAGTGGGGGCAGGAACAGG - Intergenic
997256691 5:132434460-132434482 GAGCCGGGGGGTGGGGAGACAGG - Intronic
997777189 5:136620912-136620934 GAGGCAGTGGATGGAGATACTGG - Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001814982 5:174660979-174661001 GAGCCAGTGGGGGAAGAAAAAGG + Intergenic
1003492026 6:6631317-6631339 AAGCCAGCGGGGGGTGGAACTGG + Intronic
1006003573 6:30985731-30985753 CAGCTAGTGAGTGGTGGAACAGG - Intronic
1006285353 6:33089076-33089098 GAGCCAGGGGATGGTGAAAGTGG + Intergenic
1007040936 6:38721622-38721644 GGGACAGTGGGTGGGTAAACTGG + Intronic
1007231382 6:40349628-40349650 GAGTGGGTGGGTGGTGAGACAGG + Intergenic
1014757024 6:125312637-125312659 CAGCCAGTGAGTGGTGAAGCTGG + Intergenic
1018627940 6:165798383-165798405 GACCCAGTGGGTCTTGCAACAGG - Intronic
1022462083 7:30619122-30619144 CAGCCAGTGAGTGGTGAGGCTGG + Intronic
1024358908 7:48447276-48447298 GAGGAGGTGGGTGTTGAAACAGG - Intronic
1025960897 7:66220679-66220701 GGGTGGGTGGGTGGTGAAACAGG + Intronic
1026184130 7:68068573-68068595 AAGCCAGCAGGTGGAGAAACAGG + Intergenic
1030545658 7:110892089-110892111 GAGACAATGGGTTGAGAAACAGG - Intronic
1030950902 7:115789912-115789934 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
1032539951 7:132694631-132694653 GAGCCAGGGGATAGAGAAACTGG + Intronic
1032636855 7:133718606-133718628 TAGCCAGTGAGTGGGGAAGCAGG - Intronic
1033112774 7:138596831-138596853 GAGAAAGGGGGTGGGGAAACGGG - Intronic
1033366174 7:140673701-140673723 GAGCCAGAGGGTGGAGACGCTGG - Exonic
1034130484 7:148711574-148711596 GAACCAGTTTGTAGTGAAACGGG + Intronic
1034161976 7:149000752-149000774 GAGCCACAGGGTGGGTAAACTGG - Intergenic
1034201781 7:149287262-149287284 GAGCCAGTGAGTGGTAGAGCTGG + Intronic
1034743813 7:153503979-153504001 GAGCCAATGGCTTGGGAAACTGG + Intergenic
1034922025 7:155091195-155091217 GAGCCCGTCGGTGGCCAAACAGG - Intergenic
1036612496 8:10362499-10362521 AAGGCTGTGGGTGGTGGAACTGG + Intronic
1037227134 8:16605810-16605832 GATCCAGAGGGTGGAGAAGCAGG + Intergenic
1037890064 8:22619334-22619356 GATCCAGCGGGTGGTGGAAAAGG + Exonic
1038155748 8:24988734-24988756 GAGCCAGTGTGGGGAGAAACAGG - Intergenic
1038726742 8:30088446-30088468 GCGCCAGTGAGAGGTGAAGCCGG + Intergenic
1039610035 8:38912477-38912499 GAGCCAGTGAGGGGAGAAAGGGG - Intronic
1039848357 8:41342205-41342227 CAGTTAGTGGGTGGTGAAATAGG - Intergenic
1039951368 8:42175443-42175465 GAGCCAGGGAGTGGGGAAAGGGG + Exonic
1044302874 8:90606268-90606290 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
1045491215 8:102670896-102670918 GAGCAAGTAGGTGGTGAAACGGG + Intergenic
1046227984 8:111311210-111311232 GAGCAAGTTGGTGGTGGTACAGG - Intergenic
1047966786 8:130050854-130050876 GAGTCAGGGGGTGGTGAAGGGGG + Intergenic
1048034623 8:130665847-130665869 AAGCCAGTGAGTGGTAAAGCTGG - Intergenic
1051262603 9:15279487-15279509 GAGCCAGTGGGTGGTGAAACTGG - Intronic
1054867571 9:70018157-70018179 GTGCCAGTGGGTTGTGTCACAGG + Intergenic
1055513147 9:77014756-77014778 CAGCCAGTAGGTGGCGAAGCTGG + Intergenic
1057963486 9:99479499-99479521 GAGCCAGTAAGTAGTGAAGCTGG - Intergenic
1060939273 9:127534434-127534456 CAGCCAGTGGGTGGTAGAGCTGG + Intronic
1061000085 9:127897939-127897961 CAGCCAGTAAGTGGTGAAACCGG - Exonic
1061402847 9:130377905-130377927 GAGCCAGTGGGAGATGCCACGGG - Intronic
1061472548 9:130838189-130838211 GAGCCAGTGAGTGGGGGTACTGG + Intronic
1062247994 9:135579520-135579542 TAGACAGTGGGTGGTGAATTGGG - Intergenic
1203526880 Un_GL000213v1:98423-98445 GAGCCCCTGGGTGGTGATACTGG + Intergenic
1203491357 Un_GL000224v1:108428-108450 GAGAAAGTGGGTGGTGAAGAGGG + Intergenic
1203503981 Un_KI270741v1:50298-50320 GAGAAAGTGGGTGGTGAAGAGGG + Intergenic
1186364142 X:8873969-8873991 GAGACAGTGGGGAGTGAGACAGG + Intergenic
1186523375 X:10225225-10225247 GAGCAAGAGTGTGGAGAAACAGG - Intronic
1186535391 X:10341911-10341933 GAGCCAGTGGATGCCGAGACTGG + Intergenic
1186876131 X:13820034-13820056 GAGCCAGTAGGTTGGGAACCAGG + Intronic
1187006959 X:15241578-15241600 AAGTCAGTAGGTGGTGAAGCCGG - Intronic
1188078219 X:25805709-25805731 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
1189752404 X:44235854-44235876 GAGACAGTGAGTGGTGAATGGGG - Intronic
1190023627 X:46902544-46902566 GAGCCACTGGTTGATGAAACTGG - Intergenic
1191758837 X:64624832-64624854 GATCCAGTGAGTGGAGAAAAAGG + Intergenic
1192081951 X:68056824-68056846 AAGGCAGTGGGTGTGGAAACAGG - Intronic
1192427062 X:71086776-71086798 TAGTCAGTGGGTGGAGAAAGGGG - Intergenic
1194035358 X:88864068-88864090 GTGCCAGTGAGAGGTGAAGCCGG + Intergenic
1195321676 X:103726342-103726364 CAGCCAGTGAGTGGTAAAGCCGG + Intronic
1197078936 X:122388916-122388938 GTGCCAGTGAGAGGTGAAGCTGG - Intergenic
1198574561 X:137995947-137995969 GAGGCAGAGGGTGATGAAAGAGG + Intergenic
1199556385 X:149113935-149113957 GTGCCAGTGAGAGGTGAAGCCGG - Intergenic
1199616490 X:149659854-149659876 GAGCCAGTGGGTGTGGAGAGTGG + Intergenic
1199626151 X:149743394-149743416 GAGCCAGTGGGTGTGGAGAGTGG - Intergenic
1202090512 Y:21183587-21183609 GTGCCAGTAAGAGGTGAAACCGG + Intergenic