ID: 1051265911

View in Genome Browser
Species Human (GRCh38)
Location 9:15307704-15307726
Sequence CCACCTGGACTGTAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051265902_1051265911 1 Left 1051265902 9:15307680-15307702 CCCGAGAGGCCTCTGACACACCA No data
Right 1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG No data
1051265899_1051265911 23 Left 1051265899 9:15307658-15307680 CCTTGGGTCACGGTCACTGGTCC No data
Right 1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG No data
1051265904_1051265911 -8 Left 1051265904 9:15307689-15307711 CCTCTGACACACCACCCACCTGG No data
Right 1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG No data
1051265901_1051265911 2 Left 1051265901 9:15307679-15307701 CCCCGAGAGGCCTCTGACACACC No data
Right 1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG No data
1051265903_1051265911 0 Left 1051265903 9:15307681-15307703 CCGAGAGGCCTCTGACACACCAC No data
Right 1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051265911 Original CRISPR CCACCTGGACTGTAGGTGGA AGG Intergenic
No off target data available for this crispr