ID: 1051272087

View in Genome Browser
Species Human (GRCh38)
Location 9:15365515-15365537
Sequence GGCTGGGCTTCTGGGTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272087_1051272094 5 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272094 9:15365543-15365565 CACCTCAGACACCAGCACTTTGG No data
1051272087_1051272095 6 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272087_1051272100 22 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272100 9:15365560-15365582 CTTTGGGAGGCCGATGCAGGTGG 0: 143
1: 28815
2: 120336
3: 164052
4: 163387
1051272087_1051272097 9 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272097 9:15365547-15365569 TCAGACACCAGCACTTTGGGAGG No data
1051272087_1051272099 19 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272087 Original CRISPR GGCTGGGCTTCTGGGTCCGG TGG (reversed) Intergenic
No off target data available for this crispr