ID: 1051272088

View in Genome Browser
Species Human (GRCh38)
Location 9:15365518-15365540
Sequence GCTGGCTGGGCTTCTGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2328
Summary {0: 60, 1: 116, 2: 243, 3: 336, 4: 1573}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272088_1051272102 30 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272088_1051272097 6 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272097 9:15365547-15365569 TCAGACACCAGCACTTTGGGAGG No data
1051272088_1051272095 3 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272088_1051272094 2 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272094 9:15365543-15365565 CACCTCAGACACCAGCACTTTGG No data
1051272088_1051272100 19 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272100 9:15365560-15365582 CTTTGGGAGGCCGATGCAGGTGG 0: 143
1: 28815
2: 120336
3: 164052
4: 163387
1051272088_1051272099 16 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272088 Original CRISPR GCTGGCTGGGCTTCTGGGTC CGG (reversed) Intergenic
Too many off-targets to display for this crispr