ID: 1051272089

View in Genome Browser
Species Human (GRCh38)
Location 9:15365523-15365545
Sequence GTGAAGCTGGCTGGGCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1630
Summary {0: 105, 1: 172, 2: 334, 3: 296, 4: 723}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272089_1051272097 1 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272097 9:15365547-15365569 TCAGACACCAGCACTTTGGGAGG No data
1051272089_1051272100 14 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272100 9:15365560-15365582 CTTTGGGAGGCCGATGCAGGTGG 0: 143
1: 28815
2: 120336
3: 164052
4: 163387
1051272089_1051272103 29 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272089_1051272104 30 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272089_1051272102 25 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272089_1051272099 11 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272089_1051272094 -3 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272094 9:15365543-15365565 CACCTCAGACACCAGCACTTTGG No data
1051272089_1051272095 -2 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272089 Original CRISPR GTGAAGCTGGCTGGGCTTCT GGG (reversed) Intergenic
900326843 1:2112440-2112462 ATGAAGCTGGCTGGTGTTCACGG - Intronic
900760318 1:4466132-4466154 GTGAAGGGTGCAGGGCTTCTTGG + Intergenic
901093829 1:6662470-6662492 GTGAAGCCAGCTGGACTTCCTGG + Intronic
901294907 1:8153784-8153806 GTGAATCCAGCTGGGCTTCTGGG - Intergenic
901384473 1:8898314-8898336 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
901656485 1:10772631-10772653 GTTAAACTGGCCGAGCTTCTGGG - Intronic
901776041 1:11561020-11561042 GAGAAACAGGGTGGGCTTCTGGG + Intergenic
902228614 1:15012996-15013018 GGGAACCTGGCTGAGCCTCTGGG - Intronic
902312074 1:15588724-15588746 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
902524265 1:17044861-17044883 CTGCAGCTGTCTGGGCTCCTCGG + Exonic
902837044 1:19054077-19054099 GGGAGGGTGGCCGGGCTTCTAGG - Intergenic
903970636 1:27116674-27116696 GTGTAGCTGGCTGGTCCACTGGG + Intronic
904070273 1:27790583-27790605 GTGAAGCCAGCTGGACTTCTGGG - Intronic
904362128 1:29983024-29983046 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
905567598 1:38978281-38978303 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
905642658 1:39601982-39602004 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
905642868 1:39603750-39603772 GTGAAGCCACCTGGACTTCTGGG + Intergenic
905979478 1:42210871-42210893 GTGGAGCTTGCTGCTCTTCTGGG - Intronic
906100915 1:43260751-43260773 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
906866630 1:49428114-49428136 GTGAAGCCAGCTGGGCTCCTGGG - Intronic
906988900 1:50716445-50716467 GTGAAGCCAGCTGGACTTCCTGG + Intronic
907031631 1:51177926-51177948 GTGAAGCCTGCTGGGCTTCTGGG + Intergenic
907841957 1:58167166-58167188 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
907843021 1:58174608-58174630 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
908658894 1:66417510-66417532 GTAAAGCCAGCTGGACTTCTTGG - Intergenic
908848312 1:68347647-68347669 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
909243999 1:73254115-73254137 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
909446970 1:75758513-75758535 GTGAAGCCAGCTGGACTTCCTGG + Intronic
909604701 1:77496674-77496696 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
909784457 1:79593646-79593668 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
909786727 1:79622696-79622718 GTGAAGCTGGCTGGGTTTCTGGG + Intergenic
909859201 1:80583484-80583506 GTGAAGCCGGCTGTACTTCCTGG + Intergenic
909928065 1:81461993-81462015 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
909941322 1:81615109-81615131 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
910222552 1:84902689-84902711 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
910276818 1:85458084-85458106 TTGCAGCTGGATGGGCTTATAGG - Intronic
910396841 1:86802290-86802312 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
910397884 1:86809889-86809911 GTGAAGCTAGCTGGGCTTCTGGG - Intergenic
910468824 1:87529097-87529119 GTGAAGCCGGCTAGGCTTCTGGG - Intergenic
911092837 1:94031239-94031261 GTGGAGAGGGTTGGGCTTCTGGG + Intronic
911297904 1:96140128-96140150 GTGAACCCGGCTGGGCTTCTGGG + Intergenic
911345377 1:96690692-96690714 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
911379617 1:97096490-97096512 GTGAAGCCAGCTGGACTTCCTGG + Intronic
911568834 1:99497734-99497756 GTGAATTTGGCTGGCCTTCCTGG + Intergenic
911969157 1:104408309-104408331 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
912020172 1:105098218-105098240 GTGAAGCTGGCTAGGCTTCCTGG - Intergenic
912069888 1:105796110-105796132 GTGAAGCCGGCTGGGCTTCTCGG + Intergenic
912082835 1:105958587-105958609 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
912408383 1:109461740-109461762 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
912437240 1:109670329-109670351 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
912471487 1:109910251-109910273 TTGAAGCTGGCCGGGCTGCTTGG + Intronic
912486156 1:110030309-110030331 GTGAAGCTGGCTGGTCCCTTTGG + Intergenic
912675922 1:111680566-111680588 GTGAAGCCAGCTGGACTTCCTGG - Intronic
912859369 1:113199202-113199224 CTGAAGCCGGCTGTGCTTCACGG - Intergenic
913297692 1:117337586-117337608 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
913375619 1:118148660-118148682 GTGAAGCTGCCTAGGCTTCTGGG - Intronic
913378922 1:118186805-118186827 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
913383324 1:118232879-118232901 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
913404608 1:118475759-118475781 GTGAAGCCAGCTGGGCTTCTAGG + Intergenic
913713371 1:121510049-121510071 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
913713847 1:121513647-121513669 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
915045589 1:153011729-153011751 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
915183440 1:154083388-154083410 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
915262411 1:154686675-154686697 GTGAAGCTGGCAGAGCTGCAGGG - Intergenic
915318558 1:155043355-155043377 GAGAAGCAGGCTGGGGTGCTGGG + Exonic
915563098 1:156699125-156699147 TTGCAGCTGCCTGGGCCTCTGGG - Intergenic
916034607 1:160910506-160910528 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
916083253 1:161250136-161250158 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
916084291 1:161257381-161257403 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
916365741 1:164025408-164025430 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
916656270 1:166878197-166878219 GTGAAGCCGCCTGGGCTTCTGGG + Intergenic
916975853 1:170076934-170076956 GTGAACCCAGCTGGACTTCTGGG + Intronic
917078205 1:171228194-171228216 GTGAAGCAGGCTAGGCTTCTGGG + Intergenic
917085782 1:171304889-171304911 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
917086874 1:171312409-171312431 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
917227300 1:172799035-172799057 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
917227942 1:172803671-172803693 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
917280774 1:173376478-173376500 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
917281554 1:173381761-173381783 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
917369932 1:174281521-174281543 GCGAATCCGGCTGGGCTTCTGGG - Intronic
918024098 1:180726015-180726037 GTGAAGCCAGCTGGACTTCCTGG + Intronic
918489415 1:185065018-185065040 ATGAAGCCAGCTGGACTTCTGGG + Intronic
918654463 1:187006936-187006958 GTGAAACTGACTGGGCTTCTGGG - Intergenic
918696362 1:187551081-187551103 GTGAACCCCACTGGGCTTCTGGG - Intergenic
918750526 1:188263829-188263851 GTGAAGCCAGCTGCACTTCTGGG - Intergenic
918796035 1:188897879-188897901 GTGAAGCAGGCTGGGCTTCTGGG - Intergenic
918821889 1:189267072-189267094 GTGAAGCTGGTTGGGCTTCTGGG + Intergenic
918842558 1:189560940-189560962 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
918965616 1:191343858-191343880 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
919083761 1:192895948-192895970 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
919085084 1:192911636-192911658 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
919205955 1:194422147-194422169 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
919206963 1:194431055-194431077 GTGAAGCCTGTGGGGCTTCTGGG - Intergenic
919220147 1:194617685-194617707 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
919397552 1:197069625-197069647 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
919506456 1:198404674-198404696 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
919558435 1:199091120-199091142 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
919559320 1:199097466-199097488 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
919740209 1:200976812-200976834 GTCATGCTGGCTGGCCGTCTGGG + Exonic
920301181 1:204990024-204990046 GTGAAGCTGCCTGGGATCCCGGG - Intronic
921019212 1:211221091-211221113 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
921020289 1:211228852-211228874 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
921155000 1:212432770-212432792 GTGGGGCTGGCCGGGCTACTCGG - Intergenic
921354804 1:214276018-214276040 GTGAAGCTAGCTGGACTTCCTGG - Intergenic
921743909 1:218715978-218716000 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
921938674 1:220817687-220817709 GTGAAGCCAGCTGGACTTCCTGG - Exonic
921978893 1:221233639-221233661 GTGAAGCCAGCTAGGCTTCTGGG + Intergenic
922113337 1:222584420-222584442 GTGAAGCTGGCTTTGGTACTGGG - Intronic
922417155 1:225431804-225431826 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
922735485 1:227976292-227976314 GAGAAACTGACTGGGCTTTTGGG - Intergenic
922965809 1:229689851-229689873 TTGAGGCTGGGTGGGCTTCTAGG - Intergenic
923161405 1:231317661-231317683 GTGAAGCCGGCTGGGCTTCTAGG + Intergenic
923265956 1:232314429-232314451 GTGAAGCCGGATGGGCTTCTGGG - Intergenic
923379049 1:233396243-233396265 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
923412471 1:233724076-233724098 GTGAAGCCCGCTGGGCTTCTGGG + Intergenic
923903342 1:238354488-238354510 GTGGAGCCAGCTGGGCGTCTGGG + Intergenic
923975231 1:239255557-239255579 GTGAAGCCTGCTGGGCTTCTGGG - Intergenic
924505782 1:244682376-244682398 GTGAAGCCAGCTGGACTTCCTGG - Intronic
924647649 1:245894060-245894082 GTGAAGCCAGCTGGACTTCCAGG + Intronic
924731101 1:246712266-246712288 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1062760642 10:14469-14491 GTGTCGCTATCTGGGCTTCTGGG - Intergenic
1062911171 10:1213421-1213443 CAGAAGGTGGCTGGGCTTCGAGG + Intronic
1063225952 10:4014982-4015004 GTGAAGCTGGGTCGGCTCCTGGG + Intergenic
1063414616 10:5863348-5863370 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1063759473 10:9056885-9056907 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1064081304 10:12310168-12310190 GTGAAACCAGCTGGGCTTCTGGG - Intergenic
1064219430 10:13427979-13428001 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1064601855 10:17001560-17001582 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1064602954 10:17011903-17011925 GTGAAGCCAGCTGAGCTTCTGGG - Intronic
1064603936 10:17018947-17018969 GTGAAGCCGGCTGAGCTTCTGGG - Intronic
1064618615 10:17191534-17191556 GAGCAGTTGGCTGGGTTTCTGGG - Intronic
1064665613 10:17648161-17648183 GTGAAACTAGCTGGACTTCCTGG + Intronic
1064694357 10:17950692-17950714 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1065295066 10:24266467-24266489 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1065389080 10:25163827-25163849 GTGAAGCCGGCTGAGCTTCTGGG - Intergenic
1065688824 10:28312484-28312506 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1065709362 10:28500654-28500676 GAGATGCTAGCTGGGCTTCCTGG - Intergenic
1065857201 10:29840204-29840226 GTGATCCTGGCTGAGTTTCTTGG + Intergenic
1066045070 10:31587793-31587815 GTGAAGCCAGCTGGGCTTCTTGG - Intergenic
1066149601 10:32601542-32601564 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1066479354 10:35780432-35780454 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1067103402 10:43349476-43349498 GTGAACCTGGCTGGGCATGGTGG + Intergenic
1067128015 10:43536510-43536532 GGGAAGACTGCTGGGCTTCTTGG - Intergenic
1067154049 10:43760165-43760187 GTGAATCCGGCTGGGCTTCTGGG - Intergenic
1067362875 10:45598111-45598133 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1067465885 10:46498451-46498473 CTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1067527824 10:47048850-47048872 CTGCAGCTGGCCGGGTTTCTAGG + Intergenic
1067532214 10:47082304-47082326 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1067542640 10:47166764-47166786 GTGAAGCCAGCTGGTCTTCTGGG + Intergenic
1067621302 10:47886155-47886177 CTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1067740120 10:48889160-48889182 GTGAAGGTAGCTGGCTTTCTTGG - Intronic
1067841452 10:49682793-49682815 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1067854655 10:49781818-49781840 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1067970418 10:50963868-50963890 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1068240232 10:54295143-54295165 GTGAAGCCAGCTGAGCTTCTGGG + Intronic
1068241009 10:54300625-54300647 GTGAAGCCAGCTGAGCTTCTGGG + Intronic
1068368504 10:56083665-56083687 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1068404582 10:56573314-56573336 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1068417664 10:56745147-56745169 GTGAAGCTGGCTGGGCCTTTGGG - Intergenic
1068462311 10:57343704-57343726 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1068484886 10:57645107-57645129 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1068501238 10:57841567-57841589 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1068576365 10:58688482-58688504 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1068754351 10:60634388-60634410 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1069137728 10:64785319-64785341 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1069152736 10:64985339-64985361 GTGAAGCCTGCTGGACTTCCTGG - Intergenic
1069358427 10:67614281-67614303 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1069364616 10:67684487-67684509 ATGAAGCCGGCTGGGCTTCTGGG - Intronic
1069365461 10:67690697-67690719 GTGAAGCTGGCTAGGCTTCAGGG - Intronic
1069485891 10:68823076-68823098 GTGAAGCCGGCTGGGCTTCCAGG - Intergenic
1069526339 10:69175378-69175400 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1070073155 10:73109191-73109213 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1070145223 10:73769060-73769082 GTGGAGCTGGCTGGGCTAGATGG + Exonic
1070648709 10:78219582-78219604 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1070677750 10:78424057-78424079 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1070693046 10:78541953-78541975 GTGGAGCTGGCCTGTCTTCTCGG - Intergenic
1070734879 10:78856596-78856618 GTGCAGCCAGCTGGGCTTCTTGG - Intergenic
1071054219 10:81490530-81490552 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1071156419 10:82694313-82694335 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1071220771 10:83462571-83462593 GTGAGGCTGGCTGGGCTTCTGGG + Intergenic
1071547371 10:86538728-86538750 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1071834472 10:89406223-89406245 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1071835339 10:89412218-89412240 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
1071926112 10:90410900-90410922 GTGAAGACCGCTGGTCTTCTTGG - Intergenic
1072370733 10:94764496-94764518 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1072374639 10:94802293-94802315 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1072927107 10:99625481-99625503 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1073970369 10:109040951-109040973 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1073971418 10:109048214-109048236 ATGAAGCTAGCTGGGCTTCTGGG + Intergenic
1074032150 10:109699729-109699751 GTGAAGCCGGCTCAGCTTCTGGG + Intergenic
1074265230 10:111895205-111895227 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1074612654 10:115036907-115036929 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1074613398 10:115042141-115042163 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1074742301 10:116497242-116497264 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1074742991 10:116502528-116502550 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1075254079 10:120910477-120910499 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1076067399 10:127459693-127459715 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1076533651 10:131161865-131161887 GTGGACCTGACTGAGCTTCTGGG - Intronic
1077517486 11:3010626-3010648 GAGAGGCTGGCCGGGCTGCTGGG - Intronic
1077787883 11:5404121-5404143 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1078497345 11:11831720-11831742 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1078605753 11:12774075-12774097 GTGAAGCTGGAGGGGCTGGTAGG + Intronic
1079811991 11:25007207-25007229 GTGAACCCGGCTGGGCTTCTGGG - Intronic
1079913341 11:26338185-26338207 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1079925680 11:26489064-26489086 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1080331956 11:31149250-31149272 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1081106699 11:39078920-39078942 ATGAAGCCGGCTAGGCTTCTGGG + Intergenic
1081126851 11:39332985-39333007 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
1081145634 11:39560220-39560242 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1081146437 11:39566212-39566234 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1082011611 11:47453432-47453454 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1082906475 11:58312712-58312734 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1083125786 11:60564426-60564448 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1083350156 11:62022328-62022350 GTGACTCTTGCTGGGCTTCCTGG + Intergenic
1083504692 11:63145050-63145072 GTCAAGCTGGCTGGGCATGGTGG - Intronic
1084036534 11:66514733-66514755 GTGAAGAGGGCTGGGCTCCTGGG + Intronic
1084437129 11:69149730-69149752 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1084518654 11:69649829-69649851 TTGAAGCTGGCTGGTGTTTTAGG + Intronic
1084840656 11:71843773-71843795 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1084875026 11:72124735-72124757 GGGAAGATGGCTGGACTTCGAGG - Intronic
1084932944 11:72571321-72571343 GTGCAGGAGGCTGTGCTTCTCGG - Intergenic
1085473914 11:76776797-76776819 TTGGAGTTGGCTGAGCTTCTTGG + Intergenic
1085520814 11:77138077-77138099 GTGAAGCCGCCTGGGATTCCGGG + Intronic
1085788734 11:79477364-79477386 GAGAAGCTGGTTGAGCTTGTAGG - Intergenic
1085852569 11:80139116-80139138 GGGAAGCCAGCTGGGCTTCTGGG + Intergenic
1086273426 11:85095920-85095942 GTGAAGCCAGCTGAGCTTCTGGG + Intronic
1086311080 11:85536929-85536951 GTGAAGCTGATTGGGCTTCTGGG + Intronic
1086926977 11:92651297-92651319 GTGAAGATGGCTGGGCTGAAGGG + Intronic
1087074672 11:94118250-94118272 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1087075675 11:94125292-94125314 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1087252193 11:95915175-95915197 TTGAACTTTGCTGGGCTTCTTGG + Intronic
1087318872 11:96636007-96636029 GTGAAGCAGGCTGGGCTTCTGGG + Intergenic
1087319698 11:96643233-96643255 GTGAAGCCATCTGGGCTTCTGGG + Intergenic
1087349286 11:97011008-97011030 GTGAAACCGGCTGGACTTCCTGG + Intergenic
1087404836 11:97717802-97717824 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1087445036 11:98240432-98240454 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1087445376 11:98244326-98244348 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1087458649 11:98419969-98419991 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1087459347 11:98425110-98425132 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1087744784 11:101930778-101930800 GTGAAGCCAGCTGGGCCTCTGGG - Intronic
1087874711 11:103342106-103342128 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1087960214 11:104339152-104339174 GTGAACCCGGCTGGGCTTCTGGG + Intergenic
1087962227 11:104366392-104366414 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1087964721 11:104398447-104398469 GTGAAGCCCACTAGGCTTCTGGG - Intergenic
1087965663 11:104410919-104410941 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1088214928 11:107497429-107497451 GTGAAGATGGTTGGGCTTCTGGG + Intergenic
1088239779 11:107761182-107761204 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1088493219 11:110406487-110406509 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1088494107 11:110416640-110416662 GTGAAGCCAGGTGGACTTCTGGG + Intergenic
1088959832 11:114651865-114651887 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1089466321 11:118688892-118688914 GTGAAGCCAGCTGGACTCCTGGG - Intergenic
1089954480 11:122557008-122557030 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1090083334 11:123629108-123629130 TTGAAGCAGGCTGGGGTGCTGGG + Intergenic
1090157731 11:124459339-124459361 GTGAAGCTGGCTGGGTTTCTGGG + Intergenic
1090383705 11:126344431-126344453 GTGGAGCTGTCTGAGCTGCTAGG - Intronic
1090702699 11:129310715-129310737 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1090757143 11:129802587-129802609 GTGAAGCTGTCTGGGCTCCTGGG - Intergenic
1090758386 11:129815108-129815130 GTGAAACCCGCTGGGCTTCTGGG - Intergenic
1091127033 11:133109637-133109659 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1091233363 11:134002804-134002826 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
1091355792 11:134936667-134936689 GTGACTCTTGCTGGGCTCCTGGG + Intergenic
1091574066 12:1715703-1715725 GTGAAGCCAGCTGGACTTCTGGG + Intronic
1091585596 12:1814512-1814534 CTGAAGCCAGCTGGACTTCTTGG - Intronic
1091933587 12:4416959-4416981 GTGAAGCCAGCTGGGCTTCCTGG - Intergenic
1092646553 12:10580488-10580510 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1092690015 12:11098167-11098189 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1093213292 12:16332993-16333015 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1093501946 12:19823386-19823408 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1093517750 12:20010440-20010462 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1093967414 12:25341843-25341865 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1094238542 12:28195412-28195434 GTGAAGCCGGCTGGACTTCCGGG - Intronic
1094319381 12:29169137-29169159 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1094320944 12:29182595-29182617 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1094385415 12:29888683-29888705 GTGAAGCCGGCTGGACTTCTGGG - Intergenic
1094652399 12:32390855-32390877 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1094736580 12:33241432-33241454 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1094795424 12:33966229-33966251 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1094808377 12:34112201-34112223 GTGTGGCTATCTGGGCTTCTGGG - Intergenic
1095108063 12:38259333-38259355 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1095597253 12:43972865-43972887 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1095642653 12:44502546-44502568 GTGAAGTTGGCTGGGCTTCTTGG - Intergenic
1095769442 12:45936427-45936449 ATGAAGCTGGCTGGGCGTGGTGG - Intronic
1095898835 12:47306625-47306647 GTGAAGCCTGCTGGGCTTCTGGG + Intergenic
1096052477 12:48623354-48623376 GTGAAGCCAGCTGGATTTCTGGG - Intergenic
1096409910 12:51369491-51369513 GTGAAGCTGGTTGGGGTGGTGGG - Intronic
1096440195 12:51635924-51635946 GAGAAGTTGGGTGGGCTTCTGGG - Intronic
1096924224 12:55124545-55124567 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1097414275 12:59295362-59295384 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1097427984 12:59470939-59470961 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1097428611 12:59475371-59475393 GTGAAGCCAGTTGGACTTCTGGG + Intergenic
1097547609 12:61023730-61023752 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1099414433 12:82370018-82370040 GTGAAGCCAGCTGGGCCTCTGGG - Intronic
1099415090 12:82374618-82374640 GTGAATCCAGCTGGGCTTCTGGG - Intronic
1099437235 12:82659376-82659398 GTGAAGCCGGCTGGGCTTGTGGG - Intergenic
1099576504 12:84390493-84390515 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1099577221 12:84395619-84395641 GTGAAGCCAGCTAAGCTTCTGGG - Intergenic
1099690534 12:85946379-85946401 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1099720422 12:86355314-86355336 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1100027448 12:90147504-90147526 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1100050507 12:90443765-90443787 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1100073171 12:90746547-90746569 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1100078932 12:90824245-90824267 GTGAAGCCGGCTGGGCTTCTTGG + Intergenic
1100130284 12:91484206-91484228 GTGAAGCCAGCTGGACTCCTGGG - Intergenic
1100141964 12:91630186-91630208 GTCTAGCTAGCTGGGCATCTTGG + Intergenic
1100422831 12:94454352-94454374 ATGAAGCCAGCTGGGATTCTGGG + Intronic
1100528786 12:95445460-95445482 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1100610004 12:96184021-96184043 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1100984190 12:100189256-100189278 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1101522870 12:105501288-105501310 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1101704526 12:107209709-107209731 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1101705548 12:107217293-107217315 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1101783883 12:107864645-107864667 ATGAAGCCGGCTGGGCTTCTGGG + Intergenic
1102255317 12:111411620-111411642 CTGGGGCTGGCTGTGCTTCTTGG + Intronic
1102420188 12:112797319-112797341 GTGAAGCAGGCTTGGTTTCTTGG + Intronic
1103939839 12:124495680-124495702 GTGAAGTTGGATGGGCTTAGGGG - Intronic
1104305831 12:127610373-127610395 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1104306901 12:127617704-127617726 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1104404234 12:128504301-128504323 TTGAAACTGGGTGGGATTCTGGG - Intronic
1104767938 12:131342504-131342526 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1104837231 12:131799513-131799535 GGGAGGCTGCGTGGGCTTCTGGG + Exonic
1105237135 13:18567794-18567816 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1105401188 13:20097445-20097467 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1105431807 13:20343724-20343746 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1105455815 13:20540243-20540265 GTGAAGCCAGCAGGGCTTTTGGG - Intergenic
1105476305 13:20730622-20730644 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1105520952 13:21130464-21130486 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1105665714 13:22553449-22553471 GTGAAGCTGTGTGGGCTTCTGGG - Intergenic
1105681218 13:22729235-22729257 GTGAAGCTGACTGGGCTGCTGGG - Intergenic
1105716738 13:23073613-23073635 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1105806136 13:23952761-23952783 GTGAAGCCGAGTGGGCTTCTGGG - Intergenic
1105851348 13:24339201-24339223 GTGAAGCCGGTTGCGCTTCTGGG + Intergenic
1105952610 13:25244461-25244483 GTGAGGCCAGCTGGACTTCTGGG - Intergenic
1105996404 13:25676558-25676580 GTGAAGCTGGTTGAGCTGGTTGG - Intronic
1106062872 13:26312024-26312046 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1106162309 13:27212343-27212365 GTGAACCCGGCTGGGCTTCTGGG + Intergenic
1106163388 13:27219963-27219985 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1106184856 13:27400382-27400404 GTGAAGATAGCTGGACTTCCTGG + Intergenic
1106471049 13:30054505-30054527 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1106547304 13:30742028-30742050 GTGGAGCTGGCTGGGCCTGGCGG + Intronic
1106599800 13:31177780-31177802 GCGAAGCCGGCTGGGCTTCTGGG + Intergenic
1106679419 13:31994792-31994814 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1106712305 13:32350865-32350887 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
1106841846 13:33692312-33692334 GTGAAGCCAGCAGGGCTTCTGGG - Intergenic
1106878840 13:34106796-34106818 GTGAAGTTGGCGGGACTTCCTGG - Intergenic
1106938764 13:34753281-34753303 GTGAAGCCAACTGGGCTTCTGGG + Intergenic
1106954342 13:34919259-34919281 GTGAAGTTTGATGGGTTTCTTGG - Intergenic
1107012867 13:35685243-35685265 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1107182063 13:37472632-37472654 GTGAAGTCAGCTGAGCTTCTGGG - Intergenic
1107398212 13:40040943-40040965 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1107558857 13:41542833-41542855 GTGAAGCCAGCTGGACTTCTTGG + Intergenic
1107690882 13:42951879-42951901 GTGAAGCCAGCTGGACTTCTGGG + Intronic
1107713928 13:43180021-43180043 GTGAAGCCAGTTGGACTTCTAGG + Intergenic
1107790910 13:44001411-44001433 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1107840894 13:44456558-44456580 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1107853733 13:44594614-44594636 GTGAAGCCCGCTGGGCTTCTGGG - Intergenic
1107942539 13:45387480-45387502 GTGAAGCCAACTGGGCTTCTGGG - Intergenic
1108113457 13:47102440-47102462 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1108157030 13:47595885-47595907 GTGAAGACAGCTGGGCTTCTAGG + Intergenic
1108447763 13:50526650-50526672 GAGAAACAGGCTGTGCTTCTGGG + Intronic
1108725396 13:53175279-53175301 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1108763056 13:53593413-53593435 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1108818514 13:54318088-54318110 GTGAAGCTAGCTGGGCTTCTGGG + Intergenic
1108846527 13:54685050-54685072 GTGAAGCCAGCTGGGCTTCTAGG + Intergenic
1108855464 13:54787799-54787821 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1108958268 13:56187826-56187848 GTGAAGCAGGCTGGGTTTCTGGG + Intergenic
1109138825 13:58687814-58687836 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1109140430 13:58708013-58708035 GTGAAGCCTGCTGGGCTTCTGGG - Intergenic
1109149197 13:58823619-58823641 GTGAAGCAGGCTGGGCTTCTGGG - Intergenic
1109163839 13:59009166-59009188 GTGAAGCCAACTGGGCTTCTGGG + Intergenic
1109272366 13:60268692-60268714 GAGGGGCTGGCTGGGCTTCCTGG - Intergenic
1109411295 13:61972675-61972697 GTGAAGCCAGCTGAACTTCTGGG - Intergenic
1109419786 13:62096370-62096392 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1109425168 13:62157774-62157796 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1109429367 13:62212301-62212323 GTGAAGCTGGCTGGACTTCTGGG - Intergenic
1109434012 13:62274717-62274739 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1109464500 13:62712019-62712041 GCAAAGCTGGCTGGGCTTCTGGG + Intergenic
1109500680 13:63233604-63233626 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1109503064 13:63263723-63263745 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1109508563 13:63337803-63337825 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1109534071 13:63693704-63693726 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1109674818 13:65662188-65662210 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1109735520 13:66479534-66479556 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1109993400 13:70088528-70088550 GTGAAACTAGCTGGGCATGTTGG + Intronic
1110079271 13:71290348-71290370 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1110257325 13:73446029-73446051 GTGAGGCCAGCTGGACTTCTTGG - Intergenic
1110887657 13:80658722-80658744 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1110896433 13:80758412-80758434 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1110906426 13:80896465-80896487 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1111096085 13:83517134-83517156 GCGAAGCCGGCTGGGTTTCTGGG + Intergenic
1111197520 13:84894583-84894605 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1111232626 13:85363363-85363385 ATGAAGCCAGCTGGGCTTCTCGG + Intergenic
1111250492 13:85595052-85595074 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1111258217 13:85700265-85700287 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1111337970 13:86846945-86846967 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1111532059 13:89550576-89550598 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1111540774 13:89664691-89664713 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1111710246 13:91802701-91802723 GTGAAGCTGGCTGGGCTTCCGGG - Intronic
1111722543 13:91964678-91964700 GTGAAGCTGGCTGGGCTTTTGGG - Intronic
1111729287 13:92052722-92052744 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1112286538 13:98109523-98109545 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1112635009 13:101207566-101207588 ATGAAGCTGGCTGGGCTTCTGGG + Intronic
1112859617 13:103814333-103814355 GTGAAGTCAGCTGGGCTTCTGGG + Intergenic
1112882141 13:104121122-104121144 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1112899090 13:104337621-104337643 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1113208894 13:107951585-107951607 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1113338480 13:109399598-109399620 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1113550541 13:111189913-111189935 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1113551891 13:111199084-111199106 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1113859722 13:113473295-113473317 GTGAAGCTGGGTTGGGCTCTGGG - Intronic
1114460290 14:22882352-22882374 GTGCAGCTGCCAGGCCTTCTGGG - Intergenic
1114566371 14:23635968-23635990 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1114772195 14:25440640-25440662 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1114785971 14:25599520-25599542 GTGAAGCTGGCTGGCCTTCTGGG + Intergenic
1114793048 14:25681009-25681031 GTGAAGGCAGCTGGGCTTCTGGG - Intergenic
1115057657 14:29150695-29150717 GTGAAGCCGGCTGCACTTCTGGG + Intergenic
1115284893 14:31705754-31705776 GTGAAGCCGTCTGGGCTTCTGGG - Intronic
1115285863 14:31712297-31712319 GTGAAGCCATCTGGGCTTCTGGG - Intronic
1115736866 14:36341819-36341841 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1116083272 14:40203719-40203741 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1116156142 14:41208722-41208744 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1116329799 14:43581130-43581152 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1116346900 14:43805027-43805049 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1116698215 14:48202782-48202804 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1116730465 14:48614961-48614983 GTGAAGTCGGCTGGGCTTCTGGG + Intergenic
1116799180 14:49425345-49425367 GTGATGCTGTTGGGGCTTCTGGG - Intergenic
1117015237 14:51511015-51511037 GTGAAGCTTGTAGGGCTGCTTGG + Intronic
1117372031 14:55087298-55087320 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1117650533 14:57900211-57900233 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1118379030 14:65202781-65202803 GTGAAGCTAGCTGGACTTCCTGG + Intergenic
1118532184 14:66718783-66718805 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1118547172 14:66904588-66904610 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1119117321 14:72036955-72036977 GTGTAGCCAGCTGGGCTTCTGGG + Intronic
1119300471 14:73567341-73567363 GTGAAGACCGCTGGGCTTCTGGG + Intergenic
1119696900 14:76720429-76720451 GTGAGGCTGCCTGGGCTTCCTGG - Intergenic
1119759981 14:77143359-77143381 GGGAGGCTGGCTGGGGTGCTTGG + Intronic
1120030139 14:79631638-79631660 GTGAAGCCGGCTGGGCTTTTGGG + Intronic
1120103808 14:80472529-80472551 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1120198445 14:81512976-81512998 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1120202380 14:81552246-81552268 GTGAAGCTGGCTGGGCGCGGTGG + Intergenic
1120208873 14:81614690-81614712 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1120219016 14:81711942-81711964 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1120335461 14:83148902-83148924 GTGAAGCCCGCTGGACTTCCTGG - Intergenic
1121072193 14:91034379-91034401 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1121144050 14:91568177-91568199 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1121154300 14:91668182-91668204 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1121287821 14:92750095-92750117 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1122372956 14:101239101-101239123 CTGCAGCAGGCTGGGCTTCCTGG - Intergenic
1122861394 14:104584204-104584226 GTGAACCTGGCTGGGCCCCCTGG + Intronic
1123064013 14:105607011-105607033 GTGATGGGGGCTGGGCTTCCTGG + Intergenic
1123073327 14:105652654-105652676 GTGATGGGGGCTGGGCTTCCTGG + Intergenic
1123794383 15:23756850-23756872 GTGAAGCCGGATGGGCTTCTGGG + Intergenic
1123805924 15:23873348-23873370 GTGAAATCAGCTGGGCTTCTGGG + Intergenic
1123814451 15:23962448-23962470 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1123893327 15:24803006-24803028 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1123903860 15:24903115-24903137 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1123977480 15:25566935-25566957 GTGAAGCCCGCTGGGCTTCTGGG - Intergenic
1124031685 15:26017961-26017983 GTGAAGCTGACTTGGCTTCTGGG - Intergenic
1124034829 15:26045549-26045571 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1124049812 15:26186584-26186606 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1124083066 15:26518909-26518931 GTGAAGCCAGCTGGATTTCTGGG - Intergenic
1124111228 15:26790521-26790543 GTGAAGCTGACTGCGCTTCTGGG - Intronic
1124179786 15:27461780-27461802 TTGAAGCCCGCTGGGCTTATGGG - Intronic
1124194475 15:27609170-27609192 GTGAAGGCAGCTGGCCTTCTGGG - Intergenic
1124205319 15:27713871-27713893 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1124211351 15:27767381-27767403 GTGAAGCCAGCTGGATTTCTTGG + Intronic
1124247334 15:28082051-28082073 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1124355760 15:28993689-28993711 GTGAAGCCTGTGGGGCTTCTGGG + Intronic
1124385849 15:29207717-29207739 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1124441025 15:29686415-29686437 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1124595433 15:31088061-31088083 GTGCAGCCGACTGGGCTTCTGGG + Intronic
1124642450 15:31404328-31404350 GTGAAGTCAGCTGGACTTCTGGG + Intronic
1124655997 15:31507874-31507896 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1124828970 15:33129116-33129138 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1124860569 15:33436093-33436115 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1124869128 15:33523031-33523053 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1124938960 15:34200144-34200166 GTGAAGCCAGCTGGGTTTCTGGG - Intronic
1125109558 15:36015089-36015111 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1125264551 15:37864079-37864101 TTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1125529027 15:40399411-40399433 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1126188197 15:45851221-45851243 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1126191834 15:45886170-45886192 GTGAAGCTGGCTGGGCTTCTAGG + Intergenic
1126723912 15:51611718-51611740 GTGAAGCTAGCTGGACTTCCTGG + Intronic
1126734837 15:51720631-51720653 GTGAAGCCAGCTGGACTTCCTGG + Exonic
1127093227 15:55487098-55487120 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1127323372 15:57868779-57868801 GTGAAGCCAGCTGGGCTACTTGG - Intergenic
1127754152 15:62074482-62074504 GAGAACCTGGTGGGGCTTCTGGG + Intergenic
1127875154 15:63105782-63105804 GTGAAGCCGGCTGGGCTTTTGGG - Intergenic
1128596816 15:68959581-68959603 GTGAAGCCAGCTGGACTTCTAGG + Intronic
1128748304 15:70130424-70130446 ATCAAGCTGGCTGGGCTTGTTGG + Intergenic
1128942753 15:71801960-71801982 GTGAAGCCAGCTGGACTTCTGGG + Intronic
1129293282 15:74584850-74584872 GTGAAGCTGGCGGGACTCCTGGG - Intronic
1129931966 15:79418838-79418860 GGCCAGCTGGCTGGGCTCCTAGG - Intronic
1130028561 15:80291518-80291540 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1130106269 15:80930964-80930986 GCGAGGCTGGCTGGGCTTCCTGG - Intronic
1130161828 15:81409239-81409261 GTGAAGCCACCTGGACTTCTGGG + Intergenic
1130162381 15:81414240-81414262 GTGGAGCCAGCTGGGCTTCTGGG + Intergenic
1130215477 15:81964869-81964891 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1130348509 15:83069613-83069635 GTGAAGCCAACTGGACTTCTGGG - Intergenic
1130823776 15:87522458-87522480 GTGAATATAGCTGGGCTTTTGGG - Intergenic
1130904263 15:88228784-88228806 CAGAAGCTGGAGGGGCTTCTGGG - Intronic
1130923221 15:88366248-88366270 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1131198340 15:90375136-90375158 GTGAAGCCAGCTGGGCTTCTAGG + Intergenic
1131346622 15:91655587-91655609 GTGAAGGCAGCTGGACTTCTGGG + Intergenic
1131367050 15:91850510-91850532 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1131381038 15:91964091-91964113 GTGAAGCCAGCTGAGCTTCTGGG - Intronic
1131410840 15:92207160-92207182 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1131411907 15:92214376-92214398 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1131481894 15:92789304-92789326 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1131489545 15:92850598-92850620 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1131572633 15:93554469-93554491 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1131682885 15:94742464-94742486 GGGAAGCCAGCTGGACTTCTGGG - Intergenic
1131692039 15:94837659-94837681 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1131710340 15:95047342-95047364 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1131719202 15:95148724-95148746 GTGAAGCCTGCTGGACTTCCTGG - Intergenic
1131727971 15:95247901-95247923 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1131782269 15:95872339-95872361 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1131807303 15:96136140-96136162 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1131807766 15:96140758-96140780 GTGAAGTCAGCTGGGCTTCTGGG - Intergenic
1131895889 15:97028876-97028898 GTGAAGCTAGCTGGACTTCTGGG - Intergenic
1131908783 15:97173039-97173061 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1131913380 15:97234030-97234052 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1131949260 15:97663077-97663099 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1131969319 15:97875939-97875961 CTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1132043665 15:98546729-98546751 GTGAAGCCAGCCGGACTTCTGGG - Intergenic
1132910342 16:2307263-2307285 CTGAGGCTGGCTGGGTTTCGAGG - Intronic
1133128211 16:3660347-3660369 GTGAAGCTGGCTGGGCACAGTGG + Exonic
1134031121 16:10993102-10993124 ATGAACCTGGCTGGGCTTGGTGG + Intronic
1134903788 16:17961885-17961907 GTGAAGCCAGCTGGGCTTGTGGG + Intergenic
1135224527 16:20644113-20644135 TTGAAGCCAACTGGGCTTCTGGG - Intronic
1135338938 16:21630135-21630157 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1135394875 16:22123520-22123542 GTGTACCTGGGTGGGCTTCAGGG - Intronic
1135606533 16:23830587-23830609 TTGAAGTTTGCTGAGCTTCTTGG + Intergenic
1135672969 16:24390687-24390709 CTGAAGCTAGCTGGCCTTCTTGG - Intergenic
1135902407 16:26474822-26474844 GTGAAGCCGGCTTGGCTTCTAGG - Intergenic
1136093724 16:27938715-27938737 GTGAGGATGGATGGGCTGCTTGG + Intronic
1137373242 16:47928347-47928369 GTAAAGCTGGCTGGGCTTCTGGG - Intergenic
1137375802 16:47950715-47950737 GTGAAGCCAGCTGGGCTTCCGGG + Intergenic
1137876071 16:51997758-51997780 GTGAAGGCAGCTGGGCTTCTGGG + Intergenic
1137959548 16:52868502-52868524 GTGAAGCCAGCTGAACTTCTGGG + Intergenic
1138168067 16:54821141-54821163 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1138643107 16:58401673-58401695 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1138743190 16:59334201-59334223 GTTAAGCTGGCTGGGCTTCTGGG - Intergenic
1138877712 16:60973261-60973283 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1139088491 16:63617282-63617304 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1139676007 16:68524082-68524104 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1140210151 16:72963156-72963178 GTCAGGCTGGCAGGGCTGCTTGG - Intronic
1140249089 16:73278919-73278941 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1140748307 16:78000307-78000329 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1141342237 16:83213750-83213772 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1141443637 16:84044816-84044838 GTGAATCTGGAGGGGCTTCCTGG + Intergenic
1141547450 16:84780601-84780623 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1141650916 16:85392764-85392786 GTCAAGGAGGCTGGACTTCTGGG - Intergenic
1142328602 16:89435027-89435049 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1142678079 17:1527892-1527914 ATGAAGCTGGCTGGGTGTGTTGG + Intronic
1142968076 17:3593332-3593354 TTGGAGCTGGTTGGTCTTCTAGG + Intronic
1143768309 17:9151748-9151770 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1143800514 17:9376119-9376141 GTGAAGCCGGCTGGACTTCTGGG + Intronic
1143873964 17:9977923-9977945 GTAAAGCTGGCTGGGCATGGCGG + Intronic
1144011398 17:11151539-11151561 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1144017432 17:11209370-11209392 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1144130209 17:12239436-12239458 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1144263794 17:13548614-13548636 GTGAAGCTGACTGGGCTTCTGGG + Intronic
1144394875 17:14834328-14834350 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1144709451 17:17391563-17391585 GTGAAGCCGGTTGGGCTTCTGGG + Intergenic
1144748615 17:17633181-17633203 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1145220621 17:21085673-21085695 GTGAAGTCGGCTGGGCTTCTGGG - Intergenic
1145814917 17:27788743-27788765 GTGAAGCTGCCAGGGCTTTGTGG - Intronic
1145822182 17:27847272-27847294 GTGAAGCCAGCTGGGCTTCCTGG - Intronic
1146295082 17:31643144-31643166 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1146299317 17:31676089-31676111 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1146306226 17:31731603-31731625 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1146383819 17:32351578-32351600 GTGAAGAGAGCTGGCCTTCTAGG + Intronic
1146527585 17:33580073-33580095 GTGAAGCCAGCTGGCCTTCTGGG - Intronic
1146591643 17:34132697-34132719 GTGAAGCCAGCTGGACTTCGTGG - Intronic
1147253651 17:39168500-39168522 GTGAACCTAGCTGGACTTCCTGG + Intergenic
1147400103 17:40175813-40175835 CTGATGCTGGCTGGGCTTGGTGG - Intergenic
1147404027 17:40197903-40197925 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1148018347 17:44538226-44538248 GTGAAGCTAGCTGGACTTTCTGG - Intergenic
1148502594 17:48103005-48103027 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1148800183 17:50220337-50220359 GAGAAGCTCTCTGAGCTTCTGGG - Intergenic
1149097544 17:52861824-52861846 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1149186457 17:54003571-54003593 GTGAAGGAGGCTGGTCTTGTGGG + Intergenic
1149213947 17:54332407-54332429 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1149447680 17:56726201-56726223 GGGAAGCTGGCTGTGGTTCCAGG + Intergenic
1149713260 17:58762209-58762231 GTGAAGATGGCTGGGCTTGGTGG + Intronic
1149922786 17:60675049-60675071 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1149972931 17:61237104-61237126 GTGAAGCCAGCTGGACTTCTGGG + Intronic
1149977778 17:61284007-61284029 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1150136966 17:62701414-62701436 CTGGACCTGGCAGGGCTTCTGGG + Exonic
1150154528 17:62841012-62841034 GTGTGGCTGGCTGGGATGCTTGG + Intergenic
1150178299 17:63086691-63086713 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1150339815 17:64357374-64357396 GTGAGGCTGGCTGGGCTTCCAGG - Intronic
1150646626 17:66982595-66982617 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1150693580 17:67385103-67385125 GTGAAGCCAGTTGGACTTCTTGG + Intronic
1151028108 17:70703654-70703676 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1151463094 17:74267026-74267048 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1151588276 17:75025093-75025115 GTGAAGCCGACTGGGCTTCTGGG + Intergenic
1152230999 17:79114165-79114187 GTGAACCCGGCTTGGCTCCTGGG + Intronic
1152953549 18:14823-14845 GTGTCGCTATCTGGGCTTCTGGG - Intergenic
1153071960 18:1116374-1116396 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1153300446 18:3587366-3587388 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1153413061 18:4815727-4815749 GTGAAGCTGGCTGGGCTTTTGGG + Intergenic
1153431208 18:5019264-5019286 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1153433790 18:5047544-5047566 GTGAAGCTGGCTGGTCTTCTGGG + Intergenic
1153437672 18:5085236-5085258 GGGAAGCCAGCTGGGCTTCTGGG + Intergenic
1153438409 18:5090483-5090505 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1153646562 18:7201194-7201216 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1153668484 18:7387652-7387674 GTGAGGCCAGCTGGACTTCTTGG + Intergenic
1153906705 18:9668180-9668202 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1153934850 18:9912644-9912666 GTGAAGCCAGCTGGATTTCTGGG - Intergenic
1153967106 18:10191975-10191997 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1154080154 18:11248295-11248317 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1155040821 18:22064384-22064406 CTGAAGCTGGCTGGGCGTGGTGG + Intergenic
1155475365 18:26232187-26232209 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1155477096 18:26245772-26245794 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1155574002 18:27225359-27225381 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1155602935 18:27569890-27569912 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1156118917 18:33820085-33820107 GTGAAGCTGGCTGGGCTTTTGGG - Intergenic
1156324773 18:36064389-36064411 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1156735003 18:40245584-40245606 GTGAAGCCGGCCGGGCTTCTGGG + Intergenic
1156764514 18:40635390-40635412 GTGAAGCCAGTTGGACTTCTGGG - Intergenic
1157484835 18:48079599-48079621 ATGAAGCTGGCTGGGCTTTAGGG + Intronic
1157518777 18:48330439-48330461 ATGAAGCTGGCCCGGTTTCTTGG - Intronic
1158482266 18:57832268-57832290 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1158547726 18:58410274-58410296 GTGAATCAGGCAGGGCTTCATGG - Intergenic
1158744180 18:60178629-60178651 GTGAAGCCGGCTGGGCATCTGGG - Intergenic
1158811918 18:61047578-61047600 ATGAAGCCAGCTGGACTTCTGGG + Intergenic
1159040259 18:63318307-63318329 GTGCAGCTGGCTGGACATCTCGG + Exonic
1159161591 18:64648776-64648798 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1159163238 18:64671277-64671299 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1159227989 18:65565293-65565315 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1159294029 18:66457635-66457657 GGTAAGCAGGCTGGGATTCTGGG + Intergenic
1159346683 18:67215681-67215703 GTGAAGCTGGTTGGGCTTCTGGG - Intergenic
1160048541 18:75409781-75409803 GTGCAGATGGCTGGGCTCCCCGG - Exonic
1161664026 19:5564204-5564226 GAGAAGCTGCGTGGGCTGCTCGG - Intergenic
1161897326 19:7092321-7092343 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1162107548 19:8379167-8379189 GTGAAGCCGGCTAGGCTTCTGGG + Intronic
1162108524 19:8386402-8386424 GTGAAGCCGGCTGGGCTTCTTGG + Intronic
1162205563 19:9053601-9053623 GTGAAGCCCGCTGGGCTTCTGGG + Intergenic
1163448979 19:17364486-17364508 TTGAGGCTGGCTGGGCTTGGTGG - Intronic
1163500060 19:17671040-17671062 GTGATGATGGCTGGGCCTCTTGG - Intronic
1164029504 19:21389648-21389670 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1164522139 19:28987763-28987785 GTTAAGATGGCTGGGCATGTTGG - Intergenic
1164700488 19:30280948-30280970 GTGAACATGGCTGGGCTGCTGGG + Intronic
1164993340 19:32700494-32700516 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1165068133 19:33240787-33240809 GGGAAGCTGGCAGGGCCTCGGGG - Intergenic
1165884555 19:39068653-39068675 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1166135069 19:40771682-40771704 GTGAAGATGGCTGGGCCTCTGGG - Exonic
1167473360 19:49687259-49687281 GGGGAGCTGGGGGGGCTTCTCGG + Intronic
1167781045 19:51598985-51599007 ATGAAGCTGGCTGGGCTTCTGGG + Intergenic
1167790555 19:51676243-51676265 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1167994496 19:53391431-53391453 GTTAAGCCGGCTGGGCTTCTGGG - Intronic
1168092402 19:54094901-54094923 GTGAAGCCAGCTGGACTTCCTGG - Exonic
1168472437 19:56650457-56650479 ATCAAGCTGGCTGGGCGTCGTGG - Intronic
1168640153 19:58025820-58025842 GTGAAACCGGTTGGGCTTCCAGG - Intergenic
1168701628 19:58443362-58443384 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
925421848 2:3719015-3719037 GTGAAGCCAGCTGGACTTCCTGG - Intronic
925949238 2:8895603-8895625 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
925950313 2:8903222-8903244 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
926083328 2:10006238-10006260 GTGAAGCGGGCTGGGCTGCCGGG - Intergenic
926792841 2:16592531-16592553 GTGAAGGTGTCTGGGCATCTGGG + Intronic
926905054 2:17797944-17797966 GTGAAGCTGTCTGGGCATGGTGG + Intronic
927137326 2:20106599-20106621 ATGAAGCCGGCTGGGCTTCTGGG - Intergenic
927777877 2:25915906-25915928 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
928156483 2:28881501-28881523 GTGAATCTGGATTGGATTCTGGG - Intergenic
928595975 2:32859149-32859171 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
928599109 2:32886488-32886510 GGGAAGCCAGCTGGGCTCCTGGG - Intergenic
928690898 2:33797505-33797527 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
928697494 2:33863966-33863988 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
928700151 2:33890758-33890780 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
928793882 2:34992251-34992273 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
929804402 2:45132144-45132166 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
930681772 2:54264449-54264471 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
930697066 2:54422671-54422693 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
931412058 2:62042392-62042414 GTAAAGCCGGCTGGGCTTCTGGG - Intronic
931470741 2:62535913-62535935 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
931540084 2:63322012-63322034 GTGAAGCCAGCTGGGTTTCTGGG + Intronic
931540928 2:63328060-63328082 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
931748134 2:65308341-65308363 ACTAAGCTGGCTGGGTTTCTGGG - Intergenic
932960806 2:76410100-76410122 GTGAAGCTAGCTGGACTTTCTGG - Intergenic
933067467 2:77815797-77815819 GTGAAGCCCGCTGGGCTTCTGGG - Intergenic
933153035 2:78937586-78937608 GTGGTGCTGGCAGGGCCTCTAGG - Intergenic
933341806 2:81035132-81035154 GTGAAGCCAGCTGGAATTCTGGG + Intergenic
933342509 2:81040261-81040283 GTGAAGCCAGTGGGGCTTCTGGG + Intergenic
933489500 2:82967598-82967620 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
933505994 2:83177793-83177815 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
933581076 2:84127787-84127809 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
933611295 2:84438691-84438713 GTGAAGCCAGCTGGACTTCCTGG + Intronic
933623344 2:84570246-84570268 GTGAAGCCAGCTGGACTTCCTGG + Intronic
933730912 2:85455772-85455794 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
934583340 2:95465573-95465595 GTGAAGCCAGTTGGGCTTCTGGG + Intergenic
934596110 2:95611141-95611163 GTGAAGCCAGTTGGGCTTCTGGG - Intergenic
934711554 2:96518270-96518292 GTTGAGCTGGCTGGGCTTGGTGG - Intergenic
934786667 2:97014373-97014395 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
935223697 2:101035819-101035841 GTCAGGCTGCCTGGGCCTCTGGG - Intronic
935248027 2:101236224-101236246 GTGAAGCCAGCTGAACTTCTGGG + Intronic
935761026 2:106320835-106320857 GTGAAGCCAGCTGGACTTCTTGG - Intergenic
935762427 2:106333835-106333857 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
936090137 2:109496450-109496472 GTGAAGCCAGCTGGACTTCCTGG - Intronic
936631402 2:114207026-114207048 GTGAACCCAGCTGGGCTTCTGGG + Intergenic
936922672 2:117705236-117705258 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
937210900 2:120269692-120269714 GTGAAGCCAGCTGGACTTCCTGG - Intronic
937684161 2:124677835-124677857 GTGAAGCCAGGTGGGCTTCTGGG - Intronic
937706586 2:124927753-124927775 GTGAAGCCAGCTGGACTTCGTGG + Intergenic
937763310 2:125631364-125631386 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
937766385 2:125665366-125665388 ATGAAGCCAGCTAGGCTTCTGGG - Intergenic
937771853 2:125728584-125728606 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
938038220 2:128054083-128054105 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
938056112 2:128215929-128215951 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
938129349 2:128697917-128697939 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
938153118 2:128903678-128903700 GTGAGGTTGGCTGGGCTTCTGGG - Intergenic
938163360 2:129005943-129005965 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
938177164 2:129144403-129144425 GTGTAGCCGGCTGGGCTTCTGGG - Intergenic
938485602 2:131704380-131704402 GTGAAGTTTGATGGGTTTCTTGG - Intergenic
938512644 2:131966717-131966739 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
938805582 2:134804475-134804497 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
938806562 2:134811621-134811643 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
939255844 2:139743932-139743954 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
939639726 2:144625322-144625344 GTGAAGCTTACTGAACTTCTAGG - Intergenic
939814883 2:146881692-146881714 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
939851486 2:147311315-147311337 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
939852570 2:147318716-147318738 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
939912046 2:147994926-147994948 GTGAAGCCAGCTGGACTTCCTGG + Intronic
939956347 2:148530606-148530628 GTGAAGGTAGCTGAGCTTCCTGG + Intergenic
940106399 2:150105737-150105759 GTGAAGCCAGCTGGGCTTCTCGG - Intergenic
940485551 2:154291458-154291480 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
941243056 2:163066525-163066547 GTGAAACCATCTGGGCTTCTGGG + Intergenic
941243869 2:163072735-163072757 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
941272669 2:163450255-163450277 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
941537195 2:166739010-166739032 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
941537930 2:166744499-166744521 GTGAAGACAGCTGGGCTTCTGGG - Intergenic
942101771 2:172590891-172590913 GTGAAGCCAGTTGGGCTTCTGGG - Intronic
942106481 2:172638598-172638620 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
942111924 2:172691039-172691061 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
942245445 2:174003796-174003818 GTCAGGCTGGCTCTGCTTCTGGG + Intergenic
942524494 2:176838910-176838932 GTGGATTTGGCTGGGCTTGTTGG + Intergenic
942902991 2:181145627-181145649 ATGAAGCCGGCTGGGCTTTTGGG - Intergenic
943103429 2:183513135-183513157 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
943211505 2:184973397-184973419 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
943577693 2:189650682-189650704 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
943608577 2:190005472-190005494 GTGAAGCCAGCTGGACTTCCTGG - Intronic
943744541 2:191448030-191448052 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
943855086 2:192779159-192779181 GTGAAGCCAGCGGAGCTTCTGGG - Intergenic
943868392 2:192959012-192959034 GTGAAGCTGGCTGGGCTCCTGGG - Intergenic
943897460 2:193383459-193383481 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
943899386 2:193412702-193412724 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
943902374 2:193456380-193456402 GTGAAGCCAGTTGGGCTTCTGGG + Intergenic
944053073 2:195493432-195493454 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
944237153 2:197450905-197450927 GTGAAGCCGGCTGGACTTCCGGG + Intergenic
944358605 2:198823533-198823555 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
944362171 2:198869992-198870014 GTGAAGCTGGCTGGGCGTCTGGG - Intergenic
944688198 2:202136509-202136531 GTGAAGCCTACTGGGCTTCTGGG - Intronic
944812801 2:203344637-203344659 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
944857274 2:203780021-203780043 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
945056603 2:205874677-205874699 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
945444951 2:209925796-209925818 GTGAAGCCAGCTGATCTTCTGGG - Intronic
945471148 2:210229042-210229064 CTGAAGATGGCTGGGCTTCAGGG - Intergenic
945513682 2:210734887-210734909 GTGAAGTTGGCTGCGCTTCTAGG + Intergenic
945825774 2:214718169-214718191 ATGAAGCTAGCTGGACTTCCTGG - Intergenic
946206010 2:218109232-218109254 GTGAAGCTAGCTGGGCTTTTGGG - Intergenic
947539285 2:230964180-230964202 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
948643391 2:239389020-239389042 GTGAAGCCAGCTGGACTTCTGGG + Intronic
948706918 2:239800529-239800551 GTGAAGCCAGCTGTGCTTCTGGG + Exonic
948817852 2:240522258-240522280 GTGAAGCCAGCTGAGCTTCTGGG - Intronic
1169853591 20:10079220-10079242 GTGAAGCCAGCTGGACTTCCCGG - Intergenic
1170115735 20:12857596-12857618 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1170215145 20:13883585-13883607 GAGATCCTGGCTGGGCTCCTGGG + Intronic
1170755584 20:19203167-19203189 TTGAAGTTTACTGGGCTTCTTGG + Intergenic
1171261157 20:23735757-23735779 GTGAAGACAGCTAGGCTTCTGGG + Intergenic
1171261977 20:23742110-23742132 GTGAAGCCAGCTAGGCTTCTGGG + Intergenic
1171270284 20:23811599-23811621 GTGAAGACAGCTAGGCTTCTGGG + Intergenic
1171271081 20:23817840-23817862 GTGAAGCCAGCTAGGCTTCTGGG + Intergenic
1172317260 20:33965603-33965625 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1172340260 20:34152066-34152088 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1172346552 20:34205931-34205953 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
1172491907 20:35345995-35346017 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1172873567 20:38150667-38150689 GTGAAGCTGGTTGGTATCCTGGG - Intronic
1173488073 20:43456243-43456265 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1175115176 20:56677004-56677026 GAGAAGCTGGCGGGGTTACTAGG - Intergenic
1175363405 20:58432986-58433008 GTGAAGCTGTCTGGGTGACTAGG + Intronic
1175658244 20:60790592-60790614 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1176031529 20:63015312-63015334 GGAGAGCTGGGTGGGCTTCTAGG + Intergenic
1176781122 21:13196076-13196098 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1176897027 21:14391931-14391953 TTGAGGCTGACTGGGATTCTTGG + Intergenic
1177371111 21:20204940-20204962 GTGAAGCTGGCTGGACTTCTGGG + Intergenic
1177385423 21:20403701-20403723 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1177492427 21:21844971-21844993 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1177565748 21:22818774-22818796 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
1177580947 21:23021490-23021512 GTGAAGCCGGCTGGGCTTCTAGG - Intergenic
1177691160 21:24509562-24509584 ATGAAGCCAGCTGGACTTCTGGG + Intergenic
1177715952 21:24840240-24840262 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1177967954 21:27751828-27751850 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1177978812 21:27885228-27885250 GTGAAACCGGCTGGGCTTCTGGG - Intergenic
1178065793 21:28903055-28903077 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1178109399 21:29355436-29355458 GTGAAGCCAGCTGGCCTTCTGGG - Intronic
1178259242 21:31083643-31083665 GTGAAGCTGGCTGGGCCTCTGGG - Intergenic
1178259766 21:31088365-31088387 GTGAAGCCGGCTGGGCTTGTAGG - Intergenic
1178473485 21:32916408-32916430 GTGCAGATGGCTGGAGTTCTGGG + Intergenic
1178489620 21:33041018-33041040 GAGAAGCAGGCAGGGCTGCTTGG - Intergenic
1179347902 21:40578284-40578306 GTGAAGTCAGTTGGGCTTCTGGG + Intronic
1179427403 21:41292593-41292615 ATGAAGCCAGCTGGGCTTCTGGG + Intergenic
1179895427 21:44359308-44359330 GTGAAGCCAGCTAGACTTCTGGG - Intronic
1180044798 21:45300307-45300329 CTGGAGCTGGCTGGGCTTTGAGG + Intergenic
1180186563 21:46143018-46143040 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
1180656745 22:17427838-17427860 ATGAAGCCAGCTGGGCTTCTGGG - Intronic
1180753241 22:18140860-18140882 GCAAAGCCAGCTGGGCTTCTGGG + Intronic
1180918533 22:19506274-19506296 GTGGAGCTGGCTGAACTCCTGGG + Intronic
1181450113 22:23014147-23014169 CTGGAGATGGCTGGGCTTCAGGG - Intergenic
1181894488 22:26094912-26094934 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1181981050 22:26766777-26766799 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1181993978 22:26860302-26860324 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1182130003 22:27843841-27843863 GAGAGGGTGGCTGGGCCTCTTGG + Intergenic
1182372151 22:29818917-29818939 GAGAGCCTGGCTGGGCTGCTGGG - Intronic
1182553193 22:31112944-31112966 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1182576592 22:31277010-31277032 GTGACGATGCCTGGGCTTCCAGG + Exonic
1182642944 22:31783003-31783025 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1182861818 22:33566905-33566927 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1183000774 22:34856903-34856925 GTGAAGCTGGAGGGACCTCTAGG - Intergenic
1183048350 22:35240340-35240362 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1183333874 22:37235789-37235811 GTGAATCTTGTGGGGCTTCTTGG - Intronic
1183492149 22:38122403-38122425 GTGGAGCTGTCTGAGCTTCTAGG - Intronic
1183540390 22:38426468-38426490 GGGAAGGTGGCTGGACTGCTGGG - Exonic
1184415584 22:44350171-44350193 GGGCAGCTGGCTGGGCTGCTGGG - Intergenic
1184480856 22:44746053-44746075 GGGAACCTGCCTGGGGTTCTGGG + Intronic
1184494202 22:44827835-44827857 GTGAAGTTGGCTGGGCATCTCGG + Intronic
1184690177 22:46113873-46113895 CCGAAGCTGGGTGGGCATCTGGG + Intronic
1185208595 22:49554199-49554221 CTGAAGCTGCCTGGGCCTGTCGG + Intronic
949097369 3:101267-101289 ATGAAGCTGGTGGGGTTTCTGGG + Intergenic
949133586 3:535932-535954 GCGAAGCCGGCTGGGCTTCTGGG - Intergenic
949207305 3:1455330-1455352 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
949648527 3:6127502-6127524 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
949671874 3:6406967-6406989 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
949723218 3:7014811-7014833 GTGAAGCCAGCTGGACTTCTGGG + Intronic
949741344 3:7238024-7238046 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
949790875 3:7790829-7790851 GTGAAGCCAGCTAGACTTCTGGG - Intergenic
950205289 3:11075618-11075640 GTGAAGCTGACTGCGCTTCCGGG - Intergenic
950286962 3:11752581-11752603 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
950306437 3:11918172-11918194 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
950351642 3:12359957-12359979 GTGAAGCAGGCTGGGCATAGTGG - Intronic
950445737 3:13036664-13036686 GAGAAGCTGGCCGAGCTTCCTGG - Intronic
950838314 3:15941880-15941902 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
950852610 3:16077146-16077168 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
951021118 3:17781658-17781680 GTGAAGCCAGCTGGACTTCCTGG + Intronic
951173289 3:19568456-19568478 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
951239087 3:20269435-20269457 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
951239968 3:20275738-20275760 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
951525458 3:23648611-23648633 GGGAAGGTTGCTGGGCTTCTGGG + Intergenic
952137487 3:30439685-30439707 GTAAACTTGGCTGGGCTTGTGGG + Intergenic
952302448 3:32115426-32115448 GTGAAGCCAGCTGGACTTCTTGG - Intronic
952365828 3:32674099-32674121 GTTAAGCCAGCTGGGCTTCCGGG - Intergenic
952535492 3:34304938-34304960 GTGAAGCCGGCTGCACTTCTGGG + Intergenic
952554718 3:34519392-34519414 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
952555418 3:34524573-34524595 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
952940292 3:38439077-38439099 GTGAAGCCAGTTGGACTTCTGGG - Intergenic
953098461 3:39802512-39802534 GTGAAGCTGGCTTGGCTTCTGGG + Intergenic
953582893 3:44173171-44173193 GTGAAGCTGGATGGGCTTCTGGG - Intergenic
953901578 3:46846689-46846711 GAGAAGATGCCTGGGCTCCTTGG - Intergenic
954232635 3:49229228-49229250 GTGAAGCCAGCTGGACTTCCTGG - Intronic
954367028 3:50151692-50151714 GTGGACCTGGCTGAGCTTCAGGG - Intergenic
954394423 3:50285875-50285897 CTGAGGCTGCCTGGGCATCTAGG - Intronic
954598550 3:51849809-51849831 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
954599411 3:51856250-51856272 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
955417797 3:58708883-58708905 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
956035961 3:65092286-65092308 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
956563709 3:70612258-70612280 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
956842460 3:73153394-73153416 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
956843346 3:73159709-73159731 GTGAAGCTGGCTGGGCTTCTAGG - Intergenic
957037597 3:75309284-75309306 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
957271027 3:78030133-78030155 GTGAAGCAGGCTGGGCTTCTGGG + Intergenic
957510398 3:81180694-81180716 GTGAAGCCGACTGGGCATCTGGG + Intergenic
957510604 3:81182914-81182936 GTGAAGCCGGCTTGGCTTCTGGG - Intergenic
957647876 3:82957185-82957207 GCTAATCTGGCTGGTCTTCTTGG + Intergenic
957782344 3:84835386-84835408 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
958601010 3:96297552-96297574 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
958601694 3:96302541-96302563 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
958627632 3:96646560-96646582 GTGAAGCTGGCTGGGCTTCTAGG - Intergenic
959236386 3:103727833-103727855 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
959247962 3:103899661-103899683 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
959285323 3:104400915-104400937 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
959334382 3:105045787-105045809 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
959491785 3:106998844-106998866 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
959564269 3:107818400-107818422 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
960064092 3:113352076-113352098 GTGAAGCCAGCTGGACTTCCTGG + Intronic
960227451 3:115184804-115184826 GTGAAGCCAGCTGGGTTCCTGGG - Intergenic
960295679 3:115940507-115940529 GTGAAGCCAGCTGAGCTTCTGGG - Intronic
960434541 3:117609598-117609620 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
960587966 3:119337897-119337919 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
961233598 3:125343341-125343363 GTGAAGCCAGCTGGACTTCCTGG + Intronic
961261300 3:125604331-125604353 GTGAAGCCAGCTGGGCTTCCTGG + Intergenic
961584833 3:127913867-127913889 GTGAAGCCAGCTGCACTTCTGGG + Intergenic
961746854 3:129069298-129069320 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
962177404 3:133168469-133168491 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
962238738 3:133732232-133732254 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
962297025 3:134199779-134199801 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
963020875 3:140872021-140872043 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
963021726 3:140878376-140878398 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
963034886 3:141017315-141017337 GGGAAGCCGGCTGGGCTTTTGGG + Intergenic
963103795 3:141628334-141628356 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
963403108 3:144826616-144826638 GTGAAGCCGGCTGAACTTCCTGG - Intergenic
963692764 3:148525444-148525466 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
963697335 3:148577600-148577622 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
963700299 3:148617790-148617812 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
963992673 3:151671253-151671275 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
964083732 3:152790614-152790636 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
964184320 3:153924426-153924448 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
964555053 3:157927784-157927806 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
964604925 3:158550273-158550295 GTGAAGCCAGCTGGACTTCTTGG - Intergenic
964866203 3:161264602-161264624 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
964954628 3:162337157-162337179 GTGAAGGTGGCTGGGCTTCTGGG - Intergenic
965102146 3:164311373-164311395 GCGAAGCTGGCTGGGCTTCTGGG - Intergenic
965139269 3:164814453-164814475 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
965139879 3:164818677-164818699 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
965249107 3:166319067-166319089 GTGAAGCCAGCTGGACTTCTTGG - Intergenic
966290412 3:178349553-178349575 GTGAGGCCAGCTGGGCTTCTGGG - Intergenic
966887553 3:184385125-184385147 GTGCTGCTGGCTGGGCTTGGTGG + Exonic
967477230 3:189935994-189936016 ATGAAGCCAGCTGGGCTTCTGGG - Intergenic
967541848 3:190677881-190677903 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
967583266 3:191185387-191185409 AAGAAGCTGGCTGGGCTTCTGGG + Intergenic
967584242 3:191192258-191192280 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
967882689 3:194313165-194313187 GGGAAGCGGGCTGGGCTGTTTGG - Intergenic
967950996 3:194840452-194840474 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
968055084 3:195685076-195685098 CTGAAACTGGCTGGGCGTGTTGG - Intergenic
968100816 3:195964141-195964163 CTGAAACTGGCTGGGCGTGTTGG + Intergenic
968212839 3:196863419-196863441 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
968384405 4:123569-123591 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
968957862 4:3728272-3728294 GGGAGGCTGGCTGGGCTCCAAGG - Intergenic
969047703 4:4349118-4349140 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
969781751 4:9409766-9409788 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
970150666 4:13086467-13086489 GGGAAGATGGCTGAGCTTCTGGG - Intergenic
970700477 4:18730917-18730939 GTGAAGCTAGCTGGGCCTTTGGG - Intergenic
970720522 4:18983098-18983120 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
970783715 4:19770727-19770749 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
971209106 4:24599243-24599265 GCGAAGCCAGCTGGGCTCCTGGG - Intergenic
971322095 4:25613940-25613962 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
971533739 4:27721791-27721813 GTGAAGCTAGCTGGACTTCCTGG - Intergenic
971630611 4:28988304-28988326 GTGAAGCCGGCTGGACTTCCTGG - Intergenic
971696582 4:29912148-29912170 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
971793849 4:31201702-31201724 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
971891038 4:32522106-32522128 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
971985953 4:33824192-33824214 CTGAAGCTGGCAGGACATCTGGG + Intergenic
972133650 4:35864981-35865003 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
972607833 4:40630281-40630303 GTGGTTCTGGCTGGGTTTCTCGG - Intronic
972784611 4:42315219-42315241 GTGAAGCCGGCTGGACTTCTGGG - Intergenic
972790875 4:42369843-42369865 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
972791341 4:42374093-42374115 ATGAAGCCAGCTGGGCTTCTGGG - Intergenic
972889297 4:43536544-43536566 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
973044633 4:45520271-45520293 GTGAAGCTAGCTGGGCTTCTGGG - Intergenic
973889275 4:55353178-55353200 GTGAAGCCAGCTGGACTTCCTGG + Intronic
973908284 4:55552379-55552401 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
974124240 4:57676268-57676290 GTGAAGCCAGCTGGACTTCCAGG + Intergenic
974127928 4:57718349-57718371 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
974159941 4:58125325-58125347 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
974395616 4:61330915-61330937 GTGAAGCCAGCTGGACTTCCTGG - Intronic
974480106 4:62431865-62431887 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
974509789 4:62823686-62823708 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
974526160 4:63052524-63052546 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
974527448 4:63061752-63061774 GTGATGCAGGCTGGGCTTCTGGG + Intergenic
974537843 4:63192457-63192479 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
974679874 4:65146998-65147020 TGGAAGCTGCCAGGGCTTCTGGG + Intergenic
975019263 4:69467161-69467183 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
975033884 4:69658094-69658116 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
975047605 4:69824569-69824591 GTGAAGCCAGCCGGGGTTCTTGG + Intronic
975208310 4:71669666-71669688 GTGAAGCCTGCTTGGCTTCTGGG + Intergenic
975693634 4:76990372-76990394 GTGAAGCCAGCTGGCCTTCCTGG - Intronic
976174006 4:82334297-82334319 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
976174720 4:82339274-82339296 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
976182900 4:82415834-82415856 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
976481650 4:85553678-85553700 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
976596975 4:86904063-86904085 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
976724968 4:88206915-88206937 ATGAAGCTGGCTGGGCTTCTGGG - Intronic
976727468 4:88228647-88228669 GTGAAGCCAGCTGGACTTCCTGG + Intronic
976741451 4:88361229-88361251 GTGAAGCCGGCTGGGCTTTTGGG + Intergenic
976862356 4:89680618-89680640 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
977024451 4:91798512-91798534 GTGAAGCCAGCTGGACTTCCCGG + Intergenic
977081624 4:92536396-92536418 GTGAAGCCGGCTGGGTTTCTGGG - Intronic
977370267 4:96126242-96126264 GTGAAGCCGCCTGGGATTCTGGG - Intergenic
977449886 4:97181957-97181979 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
977479109 4:97551238-97551260 GTGAAGCCAGCTGGGCTTCCTGG - Intronic
977640603 4:99354249-99354271 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
977640769 4:99355702-99355724 ATGAAGCCAGCTGGGCTTCTGGG + Intergenic
977821596 4:101478311-101478333 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
977834350 4:101631516-101631538 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
977835271 4:101638402-101638424 GTGAAACTGGCTGGGCTTCTGGG - Intronic
978492221 4:109321648-109321670 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
978761470 4:112358915-112358937 CTGGAGCTGGCTGTGCTTCTTGG - Intronic
978944726 4:114481863-114481885 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
979281937 4:118878468-118878490 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
979613840 4:122719151-122719173 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
979780984 4:124650997-124651019 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
979953306 4:126922394-126922416 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
980001735 4:127497502-127497524 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
980065913 4:128187986-128188008 ATGATGCTGGCTCAGCTTCTAGG - Intronic
980122429 4:128741721-128741743 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
980243217 4:130203171-130203193 GTGAAACCAGCTGGGCTTCTGGG - Intergenic
980655157 4:135773324-135773346 GTGAAGCCGGCTGGGCTTTGGGG + Intergenic
980655303 4:135775062-135775084 GTGAAGCTGGCTGGGCTCCTGGG - Intergenic
980690049 4:136284026-136284048 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
980712983 4:136594511-136594533 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
980760199 4:137222835-137222857 GTGAAGCCAGCTGGCCTTCCGGG + Intergenic
980809258 4:137853806-137853828 GTGAAGCCAGCTGGGCTTCTAGG + Intergenic
980867026 4:138563723-138563745 GTGAAGTTGGCTGGGCGTGGTGG - Intergenic
981159728 4:141483666-141483688 GTGAAGCCAGCTGGACTTCTTGG + Intergenic
981170352 4:141615806-141615828 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
981726191 4:147849936-147849958 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
982024367 4:151236434-151236456 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
982036781 4:151353744-151353766 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
982112587 4:152070503-152070525 GTAAAGCTGCCTGGGCTTTGGGG + Intergenic
982224315 4:153152283-153152305 GTGCGGCTGGCTGGGCCTCGCGG + Intergenic
982441319 4:155439749-155439771 GTGGAGCCGGCTGGGCTTCTGGG + Intergenic
982486204 4:155968583-155968605 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
982583615 4:157209568-157209590 GTGAAGCTGGCTGGGCTTCTGGG - Intronic
982630257 4:157822184-157822206 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
982700732 4:158657693-158657715 GTGAAGCTGGCTAGGCTTCTGGG + Intergenic
982701795 4:158665146-158665168 GTGAAGCCGGCTAGGCTTCTGGG + Intergenic
982773016 4:159415303-159415325 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
982773715 4:159421102-159421124 GGGAAGCTGGCTGGGCTACTGGG + Intergenic
983014862 4:162600612-162600634 TTGAAGCTGGCTGGGCTTCTGGG - Intergenic
983033744 4:162836600-162836622 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
983033754 4:162836683-162836705 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
983084663 4:163428123-163428145 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
983660630 4:170127760-170127782 GTGAAGCTGGCTGGGCTTCTCGG - Intergenic
983736969 4:171073590-171073612 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
983922314 4:173359187-173359209 GTGAATCTGTCTGGGCTTCTGGG + Intergenic
983957794 4:173717622-173717644 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
984026814 4:174552442-174552464 GTGAAGCCAGCTGGACTTCTTGG - Intergenic
984095516 4:175428148-175428170 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
984228708 4:177066755-177066777 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
984266167 4:177499877-177499899 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
984324221 4:178231117-178231139 GTGAAGGCAGCGGGGCTTCTGGG + Intergenic
984340886 4:178454548-178454570 GTGAAGCCGGCTGGGCTTTAAGG + Intergenic
984404608 4:179311806-179311828 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
984409580 4:179379185-179379207 GTGAAGCCAGCTGGACGTCTGGG - Intergenic
984623566 4:181979988-181980010 TTCAACCTGCCTGGGCTTCTAGG - Intergenic
984773991 4:183464537-183464559 GTGAAGCGAGCTGGACTTCCTGG - Intergenic
984802201 4:183725585-183725607 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
984939006 4:184915459-184915481 GTGAAGCCAACTGGGCTTCTGGG - Intergenic
985312315 4:188615880-188615902 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
985322956 4:188735065-188735087 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
985423518 4:189807031-189807053 GTGAAGCCAGCTGGGCTTCCGGG - Intergenic
985560330 5:582808-582830 GTGAAGCTGCCTGGGCTTCTGGG - Intergenic
985657206 5:1138490-1138512 GTGAAGCCCGCTGGGCCTCTGGG - Intergenic
985664174 5:1173376-1173398 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
985734776 5:1573021-1573043 CTGAAACTGGCTGGGCGTGTTGG + Intergenic
985876591 5:2603409-2603431 GGAAACCTGGCAGGGCTTCTTGG + Intergenic
985907805 5:2854722-2854744 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
985984633 5:3504383-3504405 GGGCAGCTGGGTGGGCTTCGCGG - Intergenic
986335462 5:6751928-6751950 GTGATTCTGGCGGAGCTTCTGGG + Intronic
986362851 5:6998390-6998412 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
986540651 5:8840753-8840775 ATGATGCCGGCTGGGCTTCTGGG + Intergenic
986871134 5:12048170-12048192 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
986929150 5:12796180-12796202 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
987343313 5:16957304-16957326 GTGAAGCCAGCTGGACTTCCCGG + Intergenic
987346747 5:16985645-16985667 GTGAAGCAGGCAGGGCTTCTGGG - Intergenic
987361626 5:17112345-17112367 GTGAAGCCAGCTGGACTTCCTGG + Intronic
987545640 5:19307711-19307733 GTGAAGCTGTCTGGGCTTCAGGG - Intergenic
987641089 5:20613402-20613424 GCGAAGCCAGCTGGGCTTCTGGG - Intergenic
987673513 5:21045085-21045107 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
987676646 5:21083214-21083236 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
987818747 5:22934875-22934897 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
987923255 5:24310327-24310349 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
987923721 5:24314619-24314641 GTGAAGCCTGCTGGGCTTCTGGG + Intergenic
987929525 5:24387049-24387071 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
988036194 5:25830331-25830353 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
988039964 5:25876343-25876365 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
988113384 5:26852496-26852518 ATGAAGCTGGCTGGGCTTCTGGG + Intergenic
988156723 5:27462893-27462915 GTGAAGCCAGCTGGGATTCTGGG + Intergenic
988591381 5:32552928-32552950 GTGAAGCCAGCTGAGCTTCTGGG - Intronic
988605169 5:32673170-32673192 GTGAGGCCAGCTGGGCTTCTGGG - Intergenic
988605901 5:32678325-32678347 GTGAAGAAGGCTGGGCTTCTGGG - Intergenic
988684653 5:33515303-33515325 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
989207165 5:38822070-38822092 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
989281833 5:39653299-39653321 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
989292483 5:39785839-39785861 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
989314290 5:40059391-40059413 GTTAAGCAGGCTGGGCTTCTGGG + Intergenic
989495850 5:42111141-42111163 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
989496714 5:42117239-42117261 ATGAAGCTGGCTGAGCTTCTGGG + Intergenic
989565541 5:42897913-42897935 GTGAAGCTGGCTGGGATGCTGGG - Intergenic
989591026 5:43113132-43113154 GTGAAGCTAGCTGGACTTCTTGG - Intronic
989679008 5:44007383-44007405 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
989756248 5:44959026-44959048 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
989757684 5:44975321-44975343 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
989759802 5:44999958-44999980 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
989760241 5:45007159-45007181 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
989760501 5:45010198-45010220 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
989780071 5:45254191-45254213 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
989964034 5:50448500-50448522 ATGAAGCCAGCTGGGTTTCTGGG - Intergenic
989964550 5:50452361-50452383 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
990116379 5:52397278-52397300 GTGAAGCCAGCTGGGTTTCTGGG + Intergenic
990117192 5:52403296-52403318 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
990176320 5:53112344-53112366 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
990216742 5:53541192-53541214 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
990249559 5:53899057-53899079 GTCAAACTGGCTGTGCGTCTTGG + Intronic
990367336 5:55084672-55084694 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
990418827 5:55612759-55612781 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
990419514 5:55617581-55617603 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
990484999 5:56249453-56249475 GTAAAGCAGGCTAGGCTTCTGGG - Intergenic
990698211 5:58446426-58446448 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
991120592 5:63008556-63008578 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
991330153 5:65485393-65485415 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
991717626 5:69466400-69466422 TTGAAGCCAGCTGGGCTTCTGGG + Intergenic
991997750 5:72404819-72404841 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
992276986 5:75130830-75130852 GTGAAGCTGTCTGGGCTTCTGGG - Intronic
992455780 5:76914265-76914287 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
992545389 5:77809932-77809954 GTGAAGCCAGCTGGACTTCCTGG + Intronic
992758684 5:79932823-79932845 TTGAGGCTTGCTGAGCTTCTGGG + Intergenic
993068957 5:83134258-83134280 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
993768417 5:91892655-91892677 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
994230827 5:97309416-97309438 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
994232104 5:97318410-97318432 GTGAAGATGGCTGGGCTTTTGGG - Intergenic
994327836 5:98469547-98469569 CTGAAGCTGGCTGGGCTTCTGGG - Intergenic
994411323 5:99410452-99410474 GTGAAACCGGCTGGGCTTCTGGG - Intergenic
994482506 5:100354795-100354817 GTGAAACCGGCTGGGCTTCTGGG + Intergenic
994754593 5:103778932-103778954 GTGAAGACGGCTGGGCTTCCAGG - Intergenic
994756272 5:103797408-103797430 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
994773494 5:104013621-104013643 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
994782228 5:104105060-104105082 GTGAAGCCAGTGGGGCTTCTCGG - Intergenic
994848274 5:105019456-105019478 TTACAGCTGGATGGGCTTCTTGG - Intergenic
994954525 5:106510839-106510861 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
995408190 5:111826087-111826109 GTGAAGCCACCTGGGCTTCTGGG + Intronic
995582897 5:113619474-113619496 GTGAAACTGGCTGAGCTTCTGGG - Intergenic
995583835 5:113626161-113626183 GTGAAGCTGGCCAGGCTTCTGGG - Intergenic
995705993 5:114989891-114989913 GTGAAGCTGGCTAGGCTTCTGGG + Intergenic
995707411 5:114999537-114999559 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
995928609 5:117407597-117407619 ATGAAGCTGGCTGGACTTCTGGG - Intergenic
996099643 5:119433249-119433271 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
996211641 5:120818120-120818142 GTGAAACCAGCTGAGCTTCTGGG + Intergenic
996272007 5:121616916-121616938 GTGAAGCAGGCTGGGCTTCTGGG + Intergenic
996534110 5:124558338-124558360 GTGAAGCCAGCTGGACTTTTGGG - Intergenic
996650242 5:125867010-125867032 GAAAAGGTGGTTGGGCTTCTAGG + Intergenic
996665763 5:126058451-126058473 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
996680004 5:126221229-126221251 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
996681218 5:126229412-126229434 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
996780600 5:127182611-127182633 GTGAAGCCACCTGGGCTGCTGGG + Intergenic
997072008 5:130633389-130633411 GTGAAGCCCGCTGGGCTCCTGGG + Intergenic
997073216 5:130641829-130641851 GTGAAGCCGGCTGGGATTCTGGG + Intergenic
997150411 5:131487705-131487727 GTGAAGCCAGCTGGACTTCCTGG - Intronic
997241206 5:132309444-132309466 ATGATGCTGACAGGGCTTCTTGG + Intronic
997329353 5:133047763-133047785 GTGAAGCCGGCTGCGCTTCTGGG + Intergenic
997939431 5:138143525-138143547 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
998111053 5:139502949-139502971 GTGAACCCGGCTGGGCTTCTGGG + Intergenic
998112259 5:139511273-139511295 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
998215445 5:140235253-140235275 ATGAGGCTGGCTGGGCTTGGTGG - Intronic
998676825 5:144418539-144418561 GTGAAGCCAGCTAGGCTTCTGGG - Intronic
998701610 5:144708957-144708979 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
998712945 5:144848006-144848028 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
998914679 5:147001001-147001023 ATGAAGCTGGCTGGGCTTCTGGG + Intronic
998915554 5:147007296-147007318 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
999253607 5:150196912-150196934 CTGGAGCTGGCAGGGGTTCTGGG - Intronic
999417067 5:151407615-151407637 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
999445468 5:151635264-151635286 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
999605938 5:153315895-153315917 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
999794530 5:154976567-154976589 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
999818702 5:155202594-155202616 GTGAAGCTGGCTAGGCTTCTGGG - Intergenic
999954082 5:156681282-156681304 ATGGAGATGGCTGGGCTTCTGGG - Intronic
1000518353 5:162268770-162268792 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1000549809 5:162647134-162647156 GTGAAGCCAGCTGAACTTCTGGG + Intergenic
1000645027 5:163750804-163750826 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1000785326 5:165535743-165535765 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1001181859 5:169527512-169527534 GTGAAGCTGGATTGGTTTTTGGG + Intergenic
1001292674 5:170475218-170475240 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1001636530 5:173213878-173213900 GTGAAGCCAGCTGGGCTCCTGGG + Intergenic
1001697248 5:173680264-173680286 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1001813569 5:174648992-174649014 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1001840144 5:174868991-174869013 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1002085492 5:176772553-176772575 GTGAAGCCAGCTGGCCTTCCTGG + Intergenic
1002348238 5:178563026-178563048 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1002363662 5:178693855-178693877 GTGAATCCAGCTGGGCTTCTGGG - Intergenic
1002560830 5:180081053-180081075 GTGAAGTCGGCTAGGCTTCTGGG - Intergenic
1002577459 5:180182797-180182819 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1002615564 5:180453002-180453024 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1002617561 5:180465024-180465046 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1002688334 5:181032669-181032691 GTGAAGCCAGCTGGGCTTCCGGG + Intergenic
1002854024 6:1021909-1021931 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1003018098 6:2484493-2484515 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1003168796 6:3704160-3704182 GTGAAGCCAGCTGGACTTCGGGG - Intergenic
1003193423 6:3893865-3893887 GTGAAGCCAACTGGGCTTCTGGG - Intergenic
1003271934 6:4614981-4615003 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1003684032 6:8282852-8282874 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1003800021 6:9653406-9653428 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1003801081 6:9668161-9668183 GTGAAGCTGGCTGGGCTTCTGGG + Intronic
1003805389 6:9721967-9721989 GTGAAGCCGGCTGAGCTTCTGGG + Intronic
1003833382 6:10040255-10040277 GTAAAGCCAGCTGGACTTCTGGG + Intronic
1003882600 6:10491824-10491846 GTGAAACCGGCTGGGTTTCTGGG + Intergenic
1003907937 6:10719977-10719999 GTGAAGCCCGCTGGGCTTCTGGG - Intergenic
1003910759 6:10741576-10741598 GTGAAGCCGACTGGGCTTCTGGG + Intergenic
1004341763 6:14814138-14814160 GTGAAGTTGGCTAGGCTTGGTGG - Intergenic
1004497935 6:16181967-16181989 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1004530987 6:16455736-16455758 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1004545383 6:16593188-16593210 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1004550138 6:16638934-16638956 GTGAAGCCAGCTGGACTTCTTGG + Intronic
1004563776 6:16776530-16776552 TTGAAGCTGTCTCAGCTTCTAGG + Intergenic
1004586536 6:17006901-17006923 TTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1004622259 6:17341477-17341499 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1004811838 6:19270978-19271000 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1004882579 6:20023445-20023467 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1005190068 6:23211064-23211086 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1005196679 6:23295419-23295441 GTGAAGCCAGACGGGCTTCTGGG + Intergenic
1005269009 6:24143183-24143205 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1005279565 6:24258557-24258579 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1005304171 6:24497598-24497620 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1005935573 6:30518173-30518195 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1006217628 6:32458940-32458962 GTGACGCTGGCTGGGCTTCTGGG - Intergenic
1006221211 6:32493535-32493557 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1006221420 6:32495308-32495330 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1006222192 6:32500593-32500615 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1006230238 6:32580172-32580194 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1006498113 6:34438676-34438698 GTGAAGCTGGCTGGACTTTCTGG + Intergenic
1006522842 6:34581906-34581928 GTGAAGAAGGCTGGGCATATTGG + Intergenic
1006759748 6:36449638-36449660 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1006906615 6:37537329-37537351 GTGAAGGAGGGTGGACTTCTGGG + Intergenic
1007532398 6:42554394-42554416 GTGAAGCCGGCTAGGCTTCTGGG + Intergenic
1008257177 6:49317397-49317419 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1008429405 6:51398173-51398195 GTCAAGCTGGCCTGGCCTCTTGG - Intergenic
1008446568 6:51598572-51598594 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1008551752 6:52639333-52639355 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1009327355 6:62369580-62369602 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1009385057 6:63077927-63077949 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1009386298 6:63086717-63086739 GTGAAGCTAGCTGGACTTCTGGG - Intergenic
1009672960 6:66779956-66779978 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1009688221 6:66991089-66991111 GTGAAGCCAGCTTGGCTTCTGGG + Intergenic
1009690945 6:67031255-67031277 GTGAAGCGGGCTGGGCTTCTGGG + Intergenic
1009746356 6:67821727-67821749 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1009946592 6:70347754-70347776 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1009971253 6:70627857-70627879 GTGAAGCTGACTGGGCTTTTCGG - Intergenic
1010074562 6:71785320-71785342 GTGAAGTTGGCTGGGCTTCCGGG + Intergenic
1010075421 6:71791803-71791825 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1010768940 6:79806581-79806603 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1010797777 6:80137794-80137816 TTGAAGCTGGCTGGGCATGATGG + Intronic
1011225002 6:85095912-85095934 GTGAGGCCAGCTGGGCTTCCTGG + Intergenic
1011373287 6:86663672-86663694 GTGAAGCCTGCTGGGCTTCCGGG + Intergenic
1011374163 6:86672503-86672525 ATGAAGCTGGCTGGGCTTCTGGG - Intergenic
1011375417 6:86681524-86681546 ATGAAGCCAGCTGGGCTTCTGGG - Intergenic
1011404401 6:87002776-87002798 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1011825721 6:91303290-91303312 GTGAAGCTAGGTGGGCTTCTGGG - Intergenic
1012038422 6:94172781-94172803 GTGAAGCCAGATGGACTTCTGGG + Intergenic
1012133428 6:95524571-95524593 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1012440953 6:99261965-99261987 GTGAAGCCGACTGGGCTTCTGGG - Intergenic
1012441946 6:99269017-99269039 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1012522414 6:100136862-100136884 GTGCGGCTGGGTGGGCTTGTAGG - Intergenic
1012748702 6:103128143-103128165 ATGAAGTCAGCTGGGCTTCTGGG - Intergenic
1012789663 6:103677273-103677295 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1013113689 6:107084342-107084364 GTGAAGCCAGCTGGGTTTCTGGG + Intronic
1013790529 6:113831625-113831647 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1013839042 6:114368165-114368187 CTGAAGCTGGCTGGGTTAGTTGG + Intergenic
1013906945 6:115232291-115232313 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1014112525 6:117635418-117635440 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1014143036 6:117965748-117965770 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1014201811 6:118617108-118617130 GTGATGCCAGCTGGGCTTCCTGG + Intronic
1014309973 6:119787604-119787626 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1014386366 6:120806825-120806847 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1014405000 6:121040244-121040266 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1014450857 6:121579887-121579909 GTGAAGCTGGATGGGCTAGGTGG + Intergenic
1014494139 6:122099763-122099785 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1014579037 6:123111732-123111754 GTGAAACTGGCTGGGCTTCTGGG + Intergenic
1014691060 6:124564116-124564138 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1014940172 6:127429013-127429035 GTGAAGTTGGCTGGGCTTCTGGG - Intergenic
1015032625 6:128613982-128614004 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1015437831 6:133210037-133210059 GTGAAGCTAGCTGTACTTCCTGG - Intergenic
1015665727 6:135626366-135626388 GTGAAGCTGCCTGGGCTTCTGGG - Intergenic
1015999415 6:139028584-139028606 GTGAAGCGCCCTGGGCTCCTAGG - Intergenic
1016092745 6:139999498-139999520 GTGAAGCCAGCTGGGCCCCTGGG - Intergenic
1016170877 6:141014941-141014963 GTGAAGCCGGCTGGGGTCCGGGG - Intergenic
1016183541 6:141175299-141175321 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1016184703 6:141183721-141183743 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1016283898 6:142451185-142451207 GTGAAGCCACCTGAGCTTCTGGG - Intergenic
1016482231 6:144495064-144495086 GTGAAGCCAGCTGGACTCCTGGG - Intronic
1016711296 6:147175361-147175383 GTGAAGGTGGCCGGGCTTAGTGG + Intergenic
1016728864 6:147406814-147406836 ATGATGCTGGCTGGGCATCCAGG + Intergenic
1017017764 6:150115790-150115812 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
1017041476 6:150311613-150311635 GTGACGCCAGCTGGGCTTCTGGG - Intergenic
1017100906 6:150849133-150849155 GTGAATCTGGCTAGTCTTCTGGG + Intergenic
1017101870 6:150855909-150855931 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1017380370 6:153821390-153821412 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1017526843 6:155248340-155248362 GTGAAACTAGCTAGGCGTCTGGG + Intronic
1018734847 6:166679958-166679980 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1020375273 7:7478461-7478483 GTGAAGCCAGCTAGGCTCCTGGG - Intronic
1020571825 7:9872838-9872860 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1021006121 7:15397057-15397079 GTGAAGCCAACTGGGCTTCTGGG - Intronic
1021135985 7:16965609-16965631 GTGAAGCGAGCTGGACTTCCTGG + Intergenic
1021356025 7:19654298-19654320 GTGAAGCCAGCTAGACTTCTGGG - Intergenic
1021433194 7:20584730-20584752 GTGAAGCTGGCTGCGCTTCTGGG - Intergenic
1021572336 7:22078938-22078960 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1021710037 7:23406925-23406947 GTGAAGGTGGCTGGGCTTCTGGG - Intronic
1021756153 7:23855160-23855182 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1021757110 7:23862156-23862178 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1021778622 7:24079335-24079357 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1021857581 7:24872166-24872188 GGGAGGCTGGCTGGGTTTGTTGG + Intronic
1021943275 7:25700809-25700831 ATGAAGCCAGCTGGGCTTCCGGG - Intergenic
1022310647 7:29193935-29193957 GTGTAGCTGGGTTGGCTTCCCGG + Intronic
1022450323 7:30507830-30507852 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1022458552 7:30581399-30581421 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1022541289 7:31137551-31137573 GTGAACCTGGCTGGGCTTTTGGG - Intergenic
1022577959 7:31517369-31517391 GTGAAGCCGGCTGGGTTTCTGGG - Intronic
1022642940 7:32205339-32205361 GTGAATCTGGCTGGGCTTCTGGG + Intronic
1022803424 7:33797917-33797939 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1023027739 7:36066088-36066110 GTGAAGTCGCCTGGGTTTCTGGG - Intergenic
1023077624 7:36499666-36499688 GTGAAGCCAGCAGGGCTTCTGGG - Intergenic
1023105987 7:36763720-36763742 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1023151477 7:37205064-37205086 GTGAAGCCGGCTGGGCTTCTGGG - Intronic
1023167111 7:37353873-37353895 GTGGAGCCGACTGGGCTTCTGGG - Intronic
1023181826 7:37492375-37492397 GTGAAGCCAGCTGTGCTTCTGGG + Intergenic
1023243502 7:38176020-38176042 ATGAAGCCGGCTGGGCTTCTAGG - Intergenic
1023338448 7:39194386-39194408 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1023444617 7:40218465-40218487 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1023505657 7:40897709-40897731 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1023511945 7:40962389-40962411 GTGAAGCCAGCTGGGTTTCTGGG - Intergenic
1023546098 7:41318993-41319015 GTGAAGACAGCTGGGCTTCTGGG - Intergenic
1023557080 7:41435030-41435052 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1024091065 7:45940131-45940153 GTGAAGCCGGCTGGGATTCTGGG + Intergenic
1024178173 7:46861998-46862020 TGGAAGGGGGCTGGGCTTCTCGG - Intergenic
1024331930 7:48163404-48163426 GTGAAGCCAGCTGGGCTTCTTGG - Intergenic
1024443207 7:49445883-49445905 ATGAAGCCAGCTGGGCTTCTGGG + Intergenic
1024795739 7:53017428-53017450 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1024811380 7:53216860-53216882 GTGAAGCTGGCTGGGCTTGGGGG + Intergenic
1024820434 7:53322942-53322964 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1024867555 7:53921045-53921067 GTGAAGCCAGTTGGGCTTCTGGG + Intergenic
1024870111 7:53955337-53955359 GTGAAGCCAACTGGGCTTCTGGG - Intergenic
1024871179 7:53962959-53962981 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1025940344 7:66072322-66072344 GAGAAGCTGGCTGGGATCCGTGG - Intergenic
1026172759 7:67968798-67968820 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1026199426 7:68201430-68201452 GTGAAGGTGGCTGGGCTTCTGGG - Intergenic
1026379632 7:69786076-69786098 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1026541527 7:71283797-71283819 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1026673794 7:72412593-72412615 GTGAAGCCAGCTGGGCTTCTGGG - Intronic
1027552455 7:79616296-79616318 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1027562350 7:79747873-79747895 GTGAAGCCCGCTGGGCTTCTAGG + Intergenic
1027590549 7:80113672-80113694 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1027655644 7:80927334-80927356 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1027664977 7:81034018-81034040 GTGAAGCCAGGTGGGCTTCTGGG + Intergenic
1027790721 7:82636883-82636905 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1028495656 7:91456881-91456903 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1028639131 7:93023515-93023537 GTGAAGCCAGCTAGGCTTCTGGG - Intergenic
1029081739 7:97980030-97980052 GTGCAGCTGGGTGGGGTTCAGGG - Intergenic
1029290866 7:99501204-99501226 GTGAAGCTAGTTGGACTTCCTGG + Intronic
1029943089 7:104500947-104500969 GTAAAGCTGCCTGGGATTATAGG - Intronic
1030010843 7:105165384-105165406 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1030225998 7:107151743-107151765 GTGAGGCTGGCTGGGCGTTGTGG + Intronic
1030420116 7:109298995-109299017 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1030420826 7:109304312-109304334 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1030950897 7:115789899-115789921 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1031529441 7:122858243-122858265 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1031632775 7:124064472-124064494 GTGAAGCAGGCTGGGCTTCTGGG + Intergenic
1031730887 7:125299420-125299442 GTGAAGCCAGCTCGGCTTCTGGG - Intergenic
1031732363 7:125314847-125314869 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1031805894 7:126305528-126305550 GCGAAGCTAGCTGGACTTCTAGG + Intergenic
1031846003 7:126806663-126806685 GTGAAGCCGGCTGGGTTTCTGGG - Intronic
1032171293 7:129586730-129586752 GGGAAGCTGGCTGTGGATCTGGG + Intergenic
1032364158 7:131283666-131283688 CTGAAGCTGTCTGCGCATCTTGG + Intronic
1032611894 7:133423946-133423968 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1032713954 7:134488089-134488111 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1032722570 7:134562681-134562703 GTGTAGCCAGCTGGACTTCTGGG - Intronic
1032722851 7:134564844-134564866 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1032927822 7:136629178-136629200 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1033951274 7:146788041-146788063 GTGAAGCCAGCTGGGCTTCTCGG - Intronic
1033979788 7:147149414-147149436 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1034579288 7:152028648-152028670 GTGAAGCTGGCTGTGCTTCTGGG - Intronic
1034628970 7:152515889-152515911 GTGAAGCCGGCTGGGCCTGTGGG - Intergenic
1034706740 7:153152460-153152482 CTGAAGCTGGGTGGGCTTTTAGG + Intergenic
1034714270 7:153225316-153225338 GTGAAGCTAGCAGGGCTTCTTGG + Intergenic
1034870356 7:154677883-154677905 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1035050987 7:155998994-155999016 CTGCAGCTGCCTGGGTTTCTGGG + Intergenic
1035356545 7:158279384-158279406 GTGAAGCTGGCTGGGCTGCTGGG - Intronic
1035436405 7:158863398-158863420 GTGAAGCCTCCTGGGCTTCTGGG - Intronic
1035559182 8:592468-592490 GAGAAGCTGACTGGGCTTCAGGG - Intergenic
1036155012 8:6333380-6333402 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1036161180 8:6389885-6389907 GTGAAGCCTGCTGGGCTTCTGGG + Intergenic
1036837673 8:12088964-12088986 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1036859466 8:12335212-12335234 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1036952440 8:13154155-13154177 GGGAAGCCAGCTGGGCTTCTGGG - Intronic
1038246492 8:25861152-25861174 TGGAAGCTGGCTGGGATTCCTGG + Exonic
1038358831 8:26857215-26857237 TTGAAGCTGGCTGTGAGTCTTGG - Intronic
1038726746 8:30088459-30088481 GTGAAGCCGGCTAGGCTTCTGGG + Intergenic
1039276551 8:35938849-35938871 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1039693553 8:39885713-39885735 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1039810760 8:41046126-41046148 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1039998907 8:42560209-42560231 GTGAAGCCAGCTGGGCTTATGGG - Intergenic
1040000098 8:42568422-42568444 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1040065857 8:43143349-43143371 GCTAATCTGGCTGGGCTTATAGG + Intronic
1040068152 8:43165647-43165669 GTGAAACAGGCTGGGCTTAGTGG + Intronic
1040558994 8:48507057-48507079 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1040638811 8:49306622-49306644 GTGAAGCCGACTGGGCTTCTGGG + Intergenic
1040648664 8:49426648-49426670 GTGAAGCTGGCTGGGCTTCTAGG + Intergenic
1040649834 8:49435014-49435036 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1040667296 8:49650152-49650174 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1040668244 8:49656976-49656998 GTGAAGATGGCTGGGCTTCTGGG - Intergenic
1040732918 8:50471137-50471159 GTTAAGCCGGCTGGGCTTCTGGG - Intronic
1040762575 8:50868097-50868119 GGAGAGCTGGCTGGGTTTCTGGG - Intergenic
1040970891 8:53136880-53136902 ATGAAGCCAGCTGGACTTCTGGG - Intergenic
1040971842 8:53143612-53143634 GTGAAGCCACCTGGACTTCTGGG - Intergenic
1040999553 8:53437413-53437435 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1041000324 8:53443193-53443215 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1041001505 8:53459349-53459371 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1041002828 8:53468453-53468475 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1041068271 8:54102516-54102538 GTAAAGCCAGCTGGTCTTCTGGG + Intergenic
1041162269 8:55057864-55057886 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1041176911 8:55206417-55206439 GTGAAGCCAGGTGGGCTCCTGGG - Intronic
1041435869 8:57841150-57841172 GTGAAGCCAGCTGAGCTTCTGGG + Intergenic
1042037547 8:64552091-64552113 ATGAAGCTGGCTTGGCTCCTGGG - Intergenic
1042772539 8:72394927-72394949 GTGAAGCAAGCTGGACTTCCTGG + Intergenic
1042809810 8:72811972-72811994 GTGAAGCAGGCTGGGCACCATGG + Intronic
1043002065 8:74771753-74771775 GTGAAGCTGTCTGGGCTTCTGGG - Intronic
1043034404 8:75178558-75178580 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1043057117 8:75453212-75453234 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1043224104 8:77701030-77701052 GTAAAGCTGGCTGGGCTTCTGGG + Intergenic
1043256691 8:78147700-78147722 GTGAAGCCAGCTGGACTTCTTGG + Intergenic
1043393874 8:79817835-79817857 GTGCAGCTGCCTGGGCTAATGGG + Intergenic
1043597828 8:81904527-81904549 GTGAAGCTGGCTGGGTTTCTGGG + Intergenic
1043690059 8:83140244-83140266 GTGAAGCTGGTTGGGCTTCTGGG - Intergenic
1043740939 8:83810750-83810772 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1043916410 8:85927695-85927717 GTGAAGCCAGCTGAACTTCTGGG + Intergenic
1044008837 8:86967086-86967108 GTGAAGCCGGGTGGGCTTCTGGG - Intronic
1044013645 8:87025051-87025073 GTGAAGCCAGCTGGGCGTCTGGG + Intronic
1044068002 8:87722254-87722276 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1044302869 8:90606255-90606277 GTGAAGCCGGCCGGGCTTCTGGG - Intergenic
1044413820 8:91913721-91913743 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1044455994 8:92393725-92393747 GTGTAGCCGGCTGGGCTTCTGGG - Intergenic
1044457055 8:92401252-92401274 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1044600491 8:93999057-93999079 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1044748899 8:95397700-95397722 GTGAAGCCGGCTATGCTTCTGGG - Intergenic
1045198694 8:99956604-99956626 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1045297188 8:100882358-100882380 GTGAAGGTGGCTGGGAGGCTGGG + Intergenic
1045792216 8:105996649-105996671 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1045858894 8:106793625-106793647 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1045861859 8:106822500-106822522 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1045928481 8:107598072-107598094 GAGAGGCTAGCTGGGCTTCCTGG - Intergenic
1046055188 8:109070957-109070979 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1046143083 8:110120646-110120668 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1046329694 8:112698790-112698812 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1046397517 8:113659298-113659320 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1046482623 8:114841988-114842010 TTGATGCTGGCTCAGCTTCTTGG + Intergenic
1046490836 8:114951566-114951588 GTGAAGCCAACTGGGCTTCTGGG - Intergenic
1046507865 8:115159366-115159388 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1046594990 8:116251087-116251109 GTGAAGCTGGCTGGGCTTCTAGG + Intergenic
1047006748 8:120628467-120628489 GTGAGGCTGGCTGGGCATGGTGG + Intronic
1047782245 8:128119482-128119504 GTGAAGCTGGCTAGGCTTCAGGG + Intergenic
1047807437 8:128375041-128375063 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1047808502 8:128382426-128382448 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1048187275 8:132252833-132252855 GTGAAGCCAGCTGGTCTTCCTGG - Intronic
1048210477 8:132450473-132450495 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1048620725 8:136129832-136129854 GTGAAGCTGGCTGGACTTCTCGG - Intergenic
1048703016 8:137115783-137115805 GTGAAGCTGGGTGGCCTTCTGGG - Intergenic
1048756177 8:137740706-137740728 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1049509619 8:143020958-143020980 GTGCTGCTGGCTGCCCTTCTGGG + Exonic
1049790083 8:144468441-144468463 GTGAGGCGGGCTGGGGTTTTGGG + Intronic
1049827160 8:144676609-144676631 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1049832687 8:144712498-144712520 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1049944062 9:577543-577565 GTGAAGCCGGCTGAGCTTCTGGG - Intronic
1049989539 9:977925-977947 GTCGAGCTGGCTGTGCTTCTCGG + Intronic
1050091203 9:2017214-2017236 GCGGGGCTGGCTGGGCTGCTTGG + Intronic
1050456828 9:5842364-5842386 GTGAAGCCGGTTGGGCTTCTGGG - Intergenic
1050898296 9:10911230-10911252 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1051272089 9:15365523-15365545 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1051447332 9:17154600-17154622 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1051555319 9:18376068-18376090 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1051617669 9:19021680-19021702 GTGAAGCCAGCTGAGCTTCTGGG + Intronic
1051622921 9:19070120-19070142 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1051680328 9:19600965-19600987 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1051733928 9:20178739-20178761 GAGAAACTGCCTGTGCTTCTAGG + Intergenic
1051934830 9:22434055-22434077 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1051935865 9:22441234-22441256 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1051955454 9:22687613-22687635 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1052058216 9:23926404-23926426 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1052160154 9:25247479-25247501 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1052203306 9:25808452-25808474 GTGAAGCCGGTTGGGCTTCTGGG - Intergenic
1052318211 9:27138548-27138570 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1052372046 9:27676070-27676092 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1052432631 9:28387028-28387050 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1052654436 9:31336559-31336581 CTGAATCTGGCTGGGTTTATTGG + Intergenic
1052794137 9:32907292-32907314 GTGAAGCTGACTGGACTTCTGGG - Intergenic
1052896109 9:33749937-33749959 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1053014329 9:34653489-34653511 GTACAGCTGGCTGTGCTTCCAGG - Intronic
1053192724 9:36086745-36086767 GTGAAGCCGGCTGGGCCTCTGGG - Intronic
1053236338 9:36458149-36458171 GTGAAGCCAGCTGGACTTCTGGG + Intronic
1053421067 9:37978901-37978923 TTTAAGCAGGCTGGGCTTCCAGG + Intronic
1053532765 9:38898388-38898410 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1053590424 9:39508857-39508879 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1053598850 9:39590271-39590293 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1053848280 9:42264246-42264268 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1053856603 9:42344788-42344810 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1054204991 9:62122817-62122839 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1054575879 9:66856432-66856454 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1054633368 9:67465553-67465575 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1055241817 9:74195461-74195483 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1055410419 9:76023017-76023039 TTGTAGCTGGATGGGCTTCTAGG + Intronic
1055456580 9:76477885-76477907 GTGAAGCCAGCTGGGCTTCTGGG + Intronic
1055457845 9:76489714-76489736 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1055458657 9:76495681-76495703 GTGAAGCCAGCTGGCCTTCCTGG - Intronic
1055462050 9:76528690-76528712 GTGAAGCCAGCTGGGCTTTTGGG - Intergenic
1055636555 9:78284547-78284569 GTGAAGCTGGCTAGGCTTCTGGG - Intergenic
1055653471 9:78431000-78431022 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1055748289 9:79474925-79474947 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1055990277 9:82098639-82098661 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1056391873 9:86148418-86148440 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1056669931 9:88618309-88618331 AGGTTGCTGGCTGGGCTTCTTGG + Intergenic
1056846445 9:90041733-90041755 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1056858814 9:90160870-90160892 GTGAAGCCACCTGGACTTCTGGG + Intergenic
1056884514 9:90428274-90428296 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1056927594 9:90847991-90848013 CAGAACCTGGCTGGGGTTCTTGG + Intronic
1057001853 9:91517415-91517437 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1057049937 9:91915913-91915935 GTGAAGCCAGCTGGATTTCTGGG - Intronic
1057298538 9:93863190-93863212 GTGAAGCCAGCTGGATTTCTGGG - Intergenic
1057310437 9:93939637-93939659 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1057344345 9:94235136-94235158 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1057490925 9:95518752-95518774 CTAAAGCTACCTGGGCTTCTAGG + Intergenic
1057509352 9:95664644-95664666 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1057526172 9:95803918-95803940 GTGAAGCCAGCTGGACTTCTTGG + Intergenic
1057565602 9:96163859-96163881 GTGCAGCTGTGTGGGTTTCTAGG - Intergenic
1057625669 9:96674141-96674163 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1058065110 9:100540353-100540375 GTGAAGCCGGCTGGGCTTCTAGG - Intronic
1058265032 9:102888746-102888768 GAGAAGCCAGCTGGGCTTCTGGG + Intergenic
1058364678 9:104195014-104195036 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1058403252 9:104641423-104641445 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1060131992 9:121110652-121110674 TTGAAACTGGCTTGTCTTCTTGG + Intronic
1060565740 9:124589777-124589799 GCAAAGCTGGCTGGGCACCTTGG + Intronic
1060823235 9:126673325-126673347 GTGCTGCTGGCTGGACTTCCTGG + Intronic
1062658478 9:137615933-137615955 GTGATGCTGGCTGGCCTGCCTGG + Exonic
1185817578 X:3170510-3170532 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1185976451 X:4725855-4725877 GTGAAGCTGGCTGGACTTCTAGG - Intergenic
1186846579 X:13536663-13536685 GTGAAGCTGGCTGGGGCTGCTGG - Intergenic
1187210169 X:17222381-17222403 GTGGAGGTGGCTGCCCTTCTAGG + Intergenic
1188078214 X:25805696-25805718 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1188097327 X:26041381-26041403 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1188098141 X:26047220-26047242 GTGAAGCCAGCTAGACTTCTGGG + Intergenic
1188176972 X:27002829-27002851 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1188248071 X:27857707-27857729 GTGAAGCCGGCTGGGTTTCTGGG - Intergenic
1188766291 X:34096029-34096051 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1189187877 X:39069979-39070001 GTGAAGTTGGCTGGACTTCTGGG - Intergenic
1189732326 X:44034255-44034277 GTGAAACTGGGTGGGCTTTGTGG - Intergenic
1189810698 X:44778280-44778302 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1189900634 X:45702556-45702578 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1189952205 X:46244454-46244476 GTGAAGCTGGCTGAGCTTCTGGG - Intergenic
1190541022 X:51479203-51479225 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1191927527 X:66329422-66329444 GTGAAGCCGGCTGGGCTTCTGGG + Intergenic
1192027486 X:67469562-67469584 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1192130095 X:68541689-68541711 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1192223723 X:69214636-69214658 GGGCAGCTTGCTGGGCATCTAGG - Intergenic
1192444282 X:71198939-71198961 GCGAAGCTGGCTGGGCGTGGTGG - Intergenic
1192483207 X:71502487-71502509 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1192484549 X:71513770-71513792 GTGAAGCCAGCTGGACTTCCTGG + Intronic
1192486263 X:71529492-71529514 GTGAAGCCAGCTGGACTTCTGGG - Intronic
1193145763 X:78074050-78074072 GTGAAACCAGCTGAGCTTCTGGG - Intronic
1193264879 X:79456218-79456240 GTGAAGCCCACTGGGCTTCTGGG + Intergenic
1193870880 X:86796402-86796424 GTGAAGCCAGCTGGACTTCCTGG - Intronic
1193888521 X:87013450-87013472 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1193962153 X:87939669-87939691 GTGAATCCAGCTGGGCTTCTGGG - Intergenic
1194021000 X:88692384-88692406 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1194066652 X:89269715-89269737 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1194077723 X:89417281-89417303 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1194155617 X:90384233-90384255 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1194376998 X:93149108-93149130 GTGAAGCTGGCTGGGCGTCTGGG + Intergenic
1194408917 X:93532869-93532891 GTGAAGCCAGCTGGACTTCTGGG + Intergenic
1194451164 X:94046066-94046088 GCTGGGCTGGCTGGGCTTCTGGG + Intergenic
1194478510 X:94390477-94390499 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1194794740 X:98197898-98197920 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1194892623 X:99398762-99398784 CTGAAGCGCTCTGGGCTTCTAGG - Intergenic
1195439144 X:104882465-104882487 GTGAAGCCGGCTGGGCTTCTGGG + Intronic
1195657446 X:107345528-107345550 GTGAAAGTGGCTGGGCTTGGTGG + Intergenic
1195706607 X:107742142-107742164 GTGATGTGGGCTGGGCTTCCGGG + Intronic
1195909630 X:109876187-109876209 GTGGGGCTTGCTGGGCTTGTGGG - Intergenic
1195928683 X:110051633-110051655 ATTCAGCTGGCTTGGCTTCTGGG + Intronic
1196126773 X:112109723-112109745 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1196127740 X:112116749-112116771 GTGAAGCCAGTTGGACTTCTGGG - Intergenic
1196319453 X:114270476-114270498 GTGAAGCCAGCTGGGCTCCTGGG - Intergenic
1196378412 X:115061763-115061785 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1196419804 X:115509824-115509846 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1196419849 X:115510132-115510154 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1196488594 X:116243389-116243411 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1196663643 X:118294398-118294420 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1196853041 X:119956894-119956916 GTGAAGCCAGCTGGACTTCTGGG - Intergenic
1197078931 X:122388903-122388925 GTGAAGCTGGCTGGGCTTCTGGG - Intergenic
1197512983 X:127394643-127394665 ATAAAGCCAGCTGGGCTTCTGGG + Intergenic
1198040604 X:132847882-132847904 CTGATGCTAGCTGGGCTTCTTGG - Intronic
1198416087 X:136421131-136421153 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1198465835 X:136904084-136904106 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1198710183 X:139493037-139493059 GTGATTCTGGCAGGGCTTTTTGG + Intergenic
1198977327 X:142351439-142351461 GTGAAGCTAGCTGGACTTCCTGG + Intergenic
1199082150 X:143588974-143588996 GTAAAGCCAGCTGGGCTCCTGGG - Intergenic
1199278860 X:145976250-145976272 CTGAAGCTGGATGGCCCTCTGGG - Intergenic
1199437421 X:147828521-147828543 GTGAGGCTGGCTGAGCTTCTGGG - Intergenic
1199443648 X:147897027-147897049 GTAAAGCCTGCTGGGCTTCTGGG - Intergenic
1199556380 X:149113922-149113944 GTGAAGCCGGCTGGGCTTCTGGG - Intergenic
1200383568 X:155865581-155865603 GTGAAGTCAGCTGGGCTTCTGGG + Intergenic
1200430375 Y:3072826-3072848 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1200569078 Y:4805220-4805242 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1200720827 Y:6603893-6603915 GTGAAGCCAGCTGGCCTTCTGGG - Intergenic
1200748375 Y:6922731-6922753 GTGAACCTGACTGGGCTTCTGGG - Intronic
1200750371 Y:6939418-6939440 GTGACGCCAGCTGGGCTTCTGGG - Intronic
1200776884 Y:7177272-7177294 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1200801379 Y:7390123-7390145 GTGAAGCCGGCTGGACTTCCTGG - Intergenic
1200880276 Y:8205508-8205530 GTGAAGTCAGCTGAGCTTCTGGG - Intergenic
1200881173 Y:8212616-8212638 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1200888349 Y:8295870-8295892 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1200958971 Y:8979977-8979999 GTGAAGCTGGCTGGGCTTCCGGG + Intergenic
1200960088 Y:8988415-8988437 GTGAAGCTAGCTGGGCTTCTGGG + Intergenic
1200962978 Y:9011937-9011959 GTGAAGCTAGCTGGGCTTCTGGG - Intergenic
1201279041 Y:12325078-12325100 GTGAAACTGGCTGGGCTTCTAGG - Intergenic
1201279173 Y:12326236-12326258 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1201321596 Y:12704103-12704125 GTGAAGCCGGCTGTACTTCCTGG - Intronic
1201361318 Y:13153060-13153082 GTGAAGGTAGCTGGACTTCCTGG - Intergenic
1201403376 Y:13627370-13627392 CTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1201404594 Y:13636781-13636803 GTGAAGCTGGCTGGGCTTCTGGG + Intergenic
1201406739 Y:13657608-13657630 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1201485891 Y:14494218-14494240 GTGAAGCCAGCTGAGCTTCCCGG - Intergenic
1201568088 Y:15387066-15387088 GTGAAGCTGGCTGTGCTTCTGGG - Intergenic
1201568948 Y:15393991-15394013 TTGAAGCCAGTTGGGCTTCTGGG - Intergenic
1201595771 Y:15667191-15667213 GTGAAGCCTGGTGGGCTTCTGGG + Intergenic
1201630884 Y:16071036-16071058 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1201648441 Y:16260964-16260986 GTGAAGCCCGCTGGACTTCCTGG - Intergenic
1201649276 Y:16266980-16267002 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1201650270 Y:16276965-16276987 GTGAAGCTGGATGGACTTCTTGG + Intergenic
1201653533 Y:16318320-16318342 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1201654369 Y:16324337-16324359 GTGAAGCCCGCTGGACTTCCTGG + Intergenic
1201676813 Y:16595208-16595230 GTGAAGCCAGCTGGACTTCCTGG + Intergenic
1201743569 Y:17348059-17348081 GTGAAGCCGGTTGGGCTTCTGGG - Intergenic
1201744348 Y:17354184-17354206 GTGAAGCCAGCTAGTCTTCTGGG - Intergenic
1201907507 Y:19100799-19100821 GTGAAGTCAGCTGGACTTCTGGG - Intergenic
1201918915 Y:19213127-19213149 GTGAAGCCAGATGGGCTTCCTGG + Intergenic
1201919827 Y:19222259-19222281 GTGAAGCCAGCTGGACTTCTTGG + Intergenic
1201985722 Y:19962633-19962655 GTGAAGCCAGCTGGGTTTCTGGG - Intergenic
1201989894 Y:20011779-20011801 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1202074299 Y:21023005-21023027 GTGAATCTGGCTGGGCTTCTGGG - Intergenic
1202082404 Y:21097580-21097602 GTGAAGCCAGCTGGACTTCCTGG - Intergenic
1202090516 Y:21183600-21183622 GTGAAACCGGCTGGATTTCTGGG + Intergenic
1202150126 Y:21836844-21836866 GAGAAGCTGGCTGGGCTTCTGGG + Intergenic
1202192999 Y:22263088-22263110 GTGAAGCCAGCTGAGCTTCTGGG - Intergenic
1202242480 Y:22785793-22785815 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1202381562 Y:24279283-24279305 GAGAAACTGACTGGGCTTTTGGG - Intergenic
1202395465 Y:24419542-24419564 GTGAAGCCAGCTGGGCTTCTGGG + Intergenic
1202475319 Y:25250550-25250572 GTGAAGCCAGCTGGGCTTCTGGG - Intergenic
1202489223 Y:25390843-25390865 GAGAAACTGACTGGGCTTTTGGG + Intergenic