ID: 1051272090

View in Genome Browser
Species Human (GRCh38)
Location 9:15365524-15365546
Sequence GGTGAAGCTGGCTGGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1297
Summary {0: 97, 1: 164, 2: 333, 3: 288, 4: 415}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272090_1051272102 24 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272090_1051272105 30 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272090_1051272100 13 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272100 9:15365560-15365582 CTTTGGGAGGCCGATGCAGGTGG 0: 143
1: 28815
2: 120336
3: 164052
4: 163387
1051272090_1051272103 28 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272090_1051272104 29 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272090_1051272095 -3 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272090_1051272097 0 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272097 9:15365547-15365569 TCAGACACCAGCACTTTGGGAGG No data
1051272090_1051272094 -4 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272094 9:15365543-15365565 CACCTCAGACACCAGCACTTTGG No data
1051272090_1051272099 10 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272090 Original CRISPR GGTGAAGCTGGCTGGGCTTC TGG (reversed) Intergenic
901294908 1:8153785-8153807 GGTGAATCCAGCTGGGCTTCTGG - Intergenic
901384472 1:8898313-8898335 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
901437370 1:9255847-9255869 GAAGAAGCCGGCTGAGCTTCTGG - Intronic
901776040 1:11561019-11561041 GGAGAAACAGGGTGGGCTTCTGG + Intergenic
902312075 1:15588725-15588747 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
902878117 1:19353114-19353136 GGTGAGGCAGGCTGGGCCACAGG + Intronic
903018622 1:20378110-20378132 GGTGAAACTGGCAGGGCTGGAGG - Intergenic
903102885 1:21048486-21048508 GGAGAAGCTATCTGGGCTGCAGG - Intronic
903620938 1:24697869-24697891 GGTGAAGGCAGCTGGGTTTCTGG - Intergenic
904070274 1:27790584-27790606 GGTGAAGCCAGCTGGACTTCTGG - Intronic
904190851 1:28742481-28742503 GGTGAAGCTGCTTGGTCTACGGG + Exonic
904260689 1:29285943-29285965 GGTGGAGCTGGCTCTGCCTCTGG - Intronic
905249806 1:36640643-36640665 GGTGAAGCAGGCTGGGTGTATGG + Intergenic
905303696 1:37003487-37003509 AGTGAAGATGTCTGAGCTTCTGG + Intronic
905567599 1:38978282-38978304 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
905642867 1:39603749-39603771 GGTGAAGCCACCTGGACTTCTGG + Intergenic
906100914 1:43260750-43260772 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
906253265 1:44327990-44328012 AGGGAAGCTGGCTGGGCTACAGG + Intronic
906866631 1:49428115-49428137 GGTGAAGCCAGCTGGGCTCCTGG - Intronic
907031630 1:51177925-51177947 GGTGAAGCCTGCTGGGCTTCTGG + Intergenic
907795140 1:57708590-57708612 GGTGAAGCTGGCTGTGACTTGGG + Intronic
907841956 1:58167165-58167187 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
907843020 1:58174607-58174629 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
908762439 1:67524578-67524600 GGTGAGGCTGTCTGAGCTGCAGG + Intergenic
908850767 1:68373505-68373527 GTTGAAGCTGGCGGCGCTGCTGG - Intergenic
909243998 1:73254114-73254136 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
909604700 1:77496673-77496695 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
909784456 1:79593645-79593667 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
909786726 1:79622695-79622717 GGTGAAGCTGGCTGGGTTTCTGG + Intergenic
909928064 1:81461992-81462014 TGTGAAGCCAGCTGGGCTTCTGG + Intronic
909941321 1:81615108-81615130 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
910222551 1:84902688-84902710 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
910396842 1:86802291-86802313 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
910397885 1:86809890-86809912 GGTGAAGCTAGCTGGGCTTCTGG - Intergenic
910425434 1:87116042-87116064 GGTGAAACTGGTGGGGCCTCAGG - Intronic
910468825 1:87529098-87529120 AGTGAAGCCGGCTAGGCTTCTGG - Intergenic
910617875 1:89219329-89219351 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
911092836 1:94031238-94031260 GGTGGAGAGGGTTGGGCTTCTGG + Intronic
911297903 1:96140127-96140149 GGTGAACCCGGCTGGGCTTCTGG + Intergenic
911835218 1:102610525-102610547 GGTGAAGCTGGCTGGGATTCTGG + Intergenic
911969158 1:104408310-104408332 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
912408384 1:109461741-109461763 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
912437241 1:109670330-109670352 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
912727480 1:112070975-112070997 GCTCAAGCTGGATGGGCTTGTGG - Intergenic
913118289 1:115716742-115716764 CGTGAAGCTGGCTTGCCCTCTGG + Intronic
913375620 1:118148661-118148683 GGTGAAGCTGCCTAGGCTTCTGG - Intronic
913713370 1:121510048-121510070 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
913713846 1:121513646-121513668 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
914234466 1:145795602-145795624 GGTGAAGCCCGCTGAGCTTCTGG - Intronic
915041903 1:152974871-152974893 GATGAAGCTGTCTGAGATTCTGG + Intergenic
915183441 1:154083389-154083411 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
915262412 1:154686676-154686698 AGTGAAGCTGGCAGAGCTGCAGG - Intergenic
915263168 1:154694275-154694297 GGTGACTCTTGCTGGGCTCCTGG - Intergenic
915321346 1:155058043-155058065 GGCGCAGCGGGCTGGGCTCCAGG - Exonic
915958698 1:160245580-160245602 GCTGAAGCTGACTGAACTTCAGG + Intronic
916034608 1:160910507-160910529 AGTGAAGCCAGCTGGGCTTCTGG - Intergenic
916083252 1:161250135-161250157 AGTGAAGCCAGCTGGACTTCTGG + Intergenic
916084290 1:161257380-161257402 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
916355213 1:163898456-163898478 GATGAAGCTGGTTGGGTTTATGG + Intergenic
916454124 1:164953077-164953099 GGAGAAGCTGCCTGGGCTGCAGG + Intergenic
916656269 1:166878196-166878218 GGTGAAGCCGCCTGGGCTTCTGG + Intergenic
916975852 1:170076933-170076955 GGTGAACCCAGCTGGACTTCTGG + Intronic
917078204 1:171228193-171228215 GGTGAAGCAGGCTAGGCTTCTGG + Intergenic
917227299 1:172799034-172799056 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
917227941 1:172803670-172803692 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
917280773 1:173376477-173376499 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
917281553 1:173381760-173381782 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
917369933 1:174281522-174281544 GGCGAATCCGGCTGGGCTTCTGG - Intronic
917446285 1:175108374-175108396 GGTGAAGCCAGCTGGGCTCCTGG - Intronic
917840887 1:178976586-178976608 GGTGAAGCAGGCTGGGACTTGGG - Intergenic
918489414 1:185065017-185065039 GATGAAGCCAGCTGGACTTCTGG + Intronic
918654464 1:187006937-187006959 GGTGAAACTGACTGGGCTTCTGG - Intergenic
918749724 1:188257987-188258009 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
918750527 1:188263830-188263852 GGTGAAGCCAGCTGCACTTCTGG - Intergenic
918796036 1:188897880-188897902 GGTGAAGCAGGCTGGGCTTCTGG - Intergenic
918821888 1:189267071-189267093 GGTGAAGCTGGTTGGGCTTCTGG + Intergenic
918892684 1:190295579-190295601 GGTGAAGCAGGCTGGGACTCAGG + Intronic
918965617 1:191343859-191343881 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
919083762 1:192895949-192895971 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
919085083 1:192911635-192911657 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
919220148 1:194617686-194617708 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
919740208 1:200976811-200976833 GGTCATGCTGGCTGGCCGTCTGG + Exonic
919962432 1:202485222-202485244 GTTGCATCTGGCTAGGCTTCAGG + Intronic
920301182 1:204990025-204990047 TGTGAAGCTGCCTGGGATCCCGG - Intronic
921019211 1:211221090-211221112 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
921020288 1:211228851-211228873 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
921047677 1:211488953-211488975 GGTGGAGCAGGCTGGGCTTGGGG + Intronic
921147043 1:212367875-212367897 GGTGAAGCTGGCTGGGGTTTGGG - Intronic
921743910 1:218715979-218716001 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
921978892 1:221233638-221233660 GGTGAAGCCAGCTAGGCTTCTGG + Intergenic
922130113 1:222769236-222769258 GGAGAAGCTGCCTGTGCTGCAGG + Intergenic
922417154 1:225431803-225431825 GGTGAAGCCAGCTGGGCTCCTGG + Intergenic
922421808 1:225465493-225465515 GGTGACGCAGGCAGGGCTACGGG + Intergenic
923265957 1:232314430-232314452 GGTGAAGCCGGATGGGCTTCTGG - Intergenic
923379050 1:233396244-233396266 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
923412470 1:233724075-233724097 GGTGAAGCCCGCTGGGCTTCTGG + Intergenic
923903341 1:238354487-238354509 GGTGGAGCCAGCTGGGCGTCTGG + Intergenic
923975232 1:239255558-239255580 GGTGAAGCCTGCTGGGCTTCTGG - Intergenic
924731100 1:246712265-246712287 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1063078824 10:2745140-2745162 CTTGCAGCTGGCTGGGATTCTGG + Intergenic
1063189989 10:3684321-3684343 GGAGGAGCTGGCTGGGTTCCAGG + Intergenic
1063225951 10:4014981-4015003 GGTGAAGCTGGGTCGGCTCCTGG + Intergenic
1063541091 10:6934536-6934558 GGTGAAGCTGGCTAGGATTCTGG - Intergenic
1063759472 10:9056884-9056906 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1064081305 10:12310169-12310191 GGTGAAACCAGCTGGGCTTCTGG - Intergenic
1064193301 10:13225908-13225930 GGTGAAGCAGGCCTGGCCTCCGG - Intronic
1064602955 10:17011904-17011926 GGTGAAGCCAGCTGAGCTTCTGG - Intronic
1064603937 10:17018948-17018970 GGTGAAGCCGGCTGAGCTTCTGG - Intronic
1064694358 10:17950693-17950715 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1065269104 10:24008601-24008623 TCTGAAGCTTGCTTGGCTTCTGG - Intronic
1065389081 10:25163828-25163850 GGTGAAGCCGGCTGAGCTTCTGG - Intergenic
1066219170 10:33318943-33318965 GGTGAAGCCAACTGGACTTCCGG + Intronic
1067154050 10:43760166-43760188 GGTGAATCCGGCTGGGCTTCTGG - Intergenic
1067465884 10:46498450-46498472 GCTGAAGCCAGCTGGGCTTCTGG + Intergenic
1067531669 10:47078746-47078768 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1067532213 10:47082303-47082325 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1067542639 10:47166763-47166785 GGTGAAGCCAGCTGGTCTTCTGG + Intergenic
1067621303 10:47886156-47886178 GCTGAAGCCAGCTGGGCTTCTGG - Intergenic
1067841453 10:49682794-49682816 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1067970417 10:50963867-50963889 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1068240231 10:54295142-54295164 GGTGAAGCCAGCTGAGCTTCTGG + Intronic
1068241008 10:54300624-54300646 GGTGAAGCCAGCTGAGCTTCTGG + Intronic
1068417665 10:56745148-56745170 GGTGAAGCTGGCTGGGCCTTTGG - Intergenic
1068462310 10:57343703-57343725 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1068576366 10:58688483-58688505 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1069137729 10:64785320-64785342 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1069364617 10:67684488-67684510 GATGAAGCCGGCTGGGCTTCTGG - Intronic
1069365462 10:67690698-67690720 GGTGAAGCTGGCTAGGCTTCAGG - Intronic
1069526338 10:69175377-69175399 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1069555109 10:69392626-69392648 GGTGAGGGTGGCTGGGCGGCAGG + Intronic
1069791642 10:71026482-71026504 GGGGAAGCCAGGTGGGCTTCAGG - Intergenic
1071220770 10:83462570-83462592 GGTGAGGCTGGCTGGGCTTCTGG + Intergenic
1071427322 10:85571948-85571970 GTTTAAGCTGTCTGAGCTTCAGG - Intergenic
1071433768 10:85627599-85627621 GGTGAGGCTTGCTGAGCTGCAGG - Intronic
1071834471 10:89406222-89406244 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1071835338 10:89412217-89412239 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
1072370734 10:94764497-94764519 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1072374640 10:94802294-94802316 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1072693093 10:97584334-97584356 TGGAAACCTGGCTGGGCTTCTGG + Exonic
1072927108 10:99625482-99625504 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1073449292 10:103600223-103600245 GGGGAAGCCGGCTGGGCTTCTGG + Exonic
1073456023 10:103637212-103637234 GCTGGAGAAGGCTGGGCTTCAGG + Intronic
1073532869 10:104248781-104248803 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1073769389 10:106719045-106719067 GGTGAAGCTGGGTGGGCTTCTGG - Intronic
1073970368 10:109040950-109040972 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1073971417 10:109048213-109048235 GATGAAGCTAGCTGGGCTTCTGG + Intergenic
1074032149 10:109699728-109699750 GGTGAAGCCGGCTCAGCTTCTGG + Intergenic
1074612653 10:115036906-115036928 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1074613397 10:115042140-115042162 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1074657978 10:115616855-115616877 GCAGAAGCTGGCTGGACTGCAGG + Intronic
1074742302 10:116497243-116497265 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1074742992 10:116502529-116502551 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1076472573 10:130729109-130729131 GGAGGAGCTGGCCTGGCTTCAGG + Intergenic
1076811369 10:132888301-132888323 GGTGAAGGTGGCAGGGGTACAGG - Intronic
1076811410 10:132888432-132888454 GGTGAAGGTGGCAGGGGTACAGG - Intronic
1076811459 10:132888591-132888613 GGTGAAGGTGGCAGGGGTGCAGG - Intronic
1077167540 11:1150574-1150596 GCTGAAGGTGCCTGGGGTTCAGG + Intergenic
1077339734 11:2020960-2020982 GGTGGAGCTGGCGGGGCCACAGG + Intergenic
1077517487 11:3010627-3010649 GGAGAGGCTGGCCGGGCTGCTGG - Intronic
1077575348 11:3378907-3378929 GGTGCAGCTGGAGGGGCCTCGGG + Intronic
1077787882 11:5404120-5404142 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1078468365 11:11567604-11567626 GGTGGGGCTGGCTGGGTTTGGGG - Intronic
1078602572 11:12746835-12746857 GCTGAAGCAGGCTGGGCTGAGGG + Intronic
1078627236 11:12968718-12968740 GGTGCTGCAGCCTGGGCTTCAGG - Intergenic
1079081634 11:17417211-17417233 GGTGAGGCTGGCTGGGCATCAGG + Intronic
1079452688 11:20610823-20610845 GTTGCAGCTGGGTGGGCTCCTGG + Intronic
1079806377 11:24935335-24935357 TGTGAAGTTGCCTGGGCTACTGG + Intronic
1079811992 11:25007208-25007230 GGTGAACCCGGCTGGGCTTCTGG - Intronic
1079925681 11:26489065-26489087 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1081106698 11:39078919-39078941 GATGAAGCCGGCTAGGCTTCTGG + Intergenic
1081126852 11:39332986-39333008 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
1082906476 11:58312713-58312735 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1083180960 11:60984887-60984909 GGAGAGGCTGGCAGGGCTTGAGG + Intronic
1083361129 11:62108965-62108987 GGTGCAGCTGTCGTGGCTTCTGG - Intergenic
1083666726 11:64279307-64279329 GTCCAAGCTGGCTGAGCTTCAGG - Intronic
1084036533 11:66514732-66514754 GGTGAAGAGGGCTGGGCTCCTGG + Intronic
1084428251 11:69097307-69097329 GGTGCAGCAGGCAGAGCTTCCGG + Intergenic
1084760729 11:71269031-71269053 GGAGAGGCTGGCTGGGGGTCGGG + Intergenic
1084840657 11:71843774-71843796 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1085520813 11:77138076-77138098 AGTGAAGCCGCCTGGGATTCCGG + Intronic
1085852568 11:80139115-80139137 GGGGAAGCCAGCTGGGCTTCTGG + Intergenic
1086273425 11:85095919-85095941 GGTGAAGCCAGCTGAGCTTCTGG + Intronic
1086311079 11:85536928-85536950 GGTGAAGCTGATTGGGCTTCTGG + Intronic
1086926976 11:92651296-92651318 TGTGAAGATGGCTGGGCTGAAGG + Intronic
1087074671 11:94118249-94118271 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1087075674 11:94125291-94125313 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1087318871 11:96636006-96636028 AGTGAAGCAGGCTGGGCTTCTGG + Intergenic
1087319697 11:96643232-96643254 GGTGAAGCCATCTGGGCTTCTGG + Intergenic
1087404837 11:97717803-97717825 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1087445035 11:98240431-98240453 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1087445377 11:98244327-98244349 AGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1087744785 11:101930779-101930801 GGTGAAGCCAGCTGGGCCTCTGG - Intronic
1087960213 11:104339151-104339173 GGTGAACCCGGCTGGGCTTCTGG + Intergenic
1087962228 11:104366393-104366415 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1087964722 11:104398448-104398470 GGTGAAGCCCACTAGGCTTCTGG - Intergenic
1088214927 11:107497428-107497450 GGTGAAGATGGTTGGGCTTCTGG + Intergenic
1088239780 11:107761183-107761205 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1088326192 11:108603928-108603950 GGAAAAGATGGCTGGGATTCTGG + Intergenic
1088493218 11:110406486-110406508 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1088494106 11:110416639-110416661 GGTGAAGCCAGGTGGACTTCTGG + Intergenic
1088959833 11:114651866-114651888 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1089302624 11:117507787-117507809 GGAAAAGCTGGCTGGGATTTAGG - Intronic
1089466322 11:118688893-118688915 GGTGAAGCCAGCTGGACTCCTGG - Intergenic
1089631670 11:119788135-119788157 GGGGAAGCTGCCTGGGCCTCTGG + Intergenic
1089954479 11:122557007-122557029 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1090157730 11:124459338-124459360 GGTGAAGCTGGCTGGGTTTCTGG + Intergenic
1090702698 11:129310714-129310736 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1090757144 11:129802588-129802610 GGTGAAGCTGTCTGGGCTCCTGG - Intergenic
1090758387 11:129815109-129815131 GGTGAAACCCGCTGGGCTTCTGG - Intergenic
1091233364 11:134002805-134002827 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
1091355791 11:134936666-134936688 GGTGACTCTTGCTGGGCTCCTGG + Intergenic
1202822719 11_KI270721v1_random:76149-76171 GGTGGAGCTGGCGGGGCCACAGG + Intergenic
1091574065 12:1715702-1715724 GGTGAAGCCAGCTGGACTTCTGG + Intronic
1091878988 12:3960973-3960995 GGGGAAGCGGGCTGGGCTGTTGG + Intergenic
1093501945 12:19823385-19823407 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1094238543 12:28195413-28195435 GGTGAAGCCGGCTGGACTTCCGG - Intronic
1094320945 12:29182596-29182618 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1094343290 12:29437246-29437268 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1094385416 12:29888684-29888706 GGTGAAGCCGGCTGGACTTCTGG - Intergenic
1094652400 12:32390856-32390878 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1094736581 12:33241433-33241455 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1094795423 12:33966228-33966250 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1095108062 12:38259332-38259354 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1095898834 12:47306624-47306646 GGTGAAGCCTGCTGGGCTTCTGG + Intergenic
1096052478 12:48623355-48623377 GGTGAAGCCAGCTGGATTTCTGG - Intergenic
1096440196 12:51635925-51635947 GGAGAAGTTGGGTGGGCTTCTGG - Intronic
1096924223 12:55124544-55124566 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1097427983 12:59470938-59470960 AGTGAAGCCAGCTGGACTTCTGG + Intergenic
1097428610 12:59475370-59475392 GGTGAAGCCAGTTGGACTTCTGG + Intergenic
1097547608 12:61023729-61023751 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1098393601 12:69995211-69995233 GGCAGAGCTGGCTGGGCTTTGGG - Intergenic
1099299879 12:80878955-80878977 GGTGAAGCCAGCTGGACTTTTGG - Intronic
1099414434 12:82370019-82370041 GGTGAAGCCAGCTGGGCCTCTGG - Intronic
1099415091 12:82374619-82374641 GGTGAATCCAGCTGGGCTTCTGG - Intronic
1099437236 12:82659377-82659399 GGTGAAGCCGGCTGGGCTTGTGG - Intergenic
1099576505 12:84390494-84390516 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1099577222 12:84395620-84395642 GGTGAAGCCAGCTAAGCTTCTGG - Intergenic
1099690533 12:85946378-85946400 AGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1100027447 12:90147503-90147525 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1100073170 12:90746546-90746568 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1100130285 12:91484207-91484229 GGTGAAGCCAGCTGGACTCCTGG - Intergenic
1101522871 12:105501289-105501311 CGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1101783882 12:107864644-107864666 GATGAAGCCGGCTGGGCTTCTGG + Intergenic
1102441134 12:112964698-112964720 GATGATGCTGCCTGGGCTCCTGG - Intronic
1103883739 12:124185968-124185990 GATGAAGCAGGCTGGGGTCCGGG - Intronic
1103939840 12:124495681-124495703 AGTGAAGTTGGATGGGCTTAGGG - Intronic
1104580849 12:130009700-130009722 GGTGTAGATGTCTGGGCTCCAGG + Intergenic
1104767939 12:131342505-131342527 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1104917886 12:132275362-132275384 GGAGAGGTTGGCTGGGCTCCGGG + Intronic
1105237136 13:18567795-18567817 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1105401189 13:20097446-20097468 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1105455816 13:20540244-20540266 GGTGAAGCCAGCAGGGCTTTTGG - Intergenic
1105665715 13:22553450-22553472 GGTGAAGCTGTGTGGGCTTCTGG - Intergenic
1105681219 13:22729236-22729258 GGTGAAGCTGACTGGGCTGCTGG - Intergenic
1105716739 13:23073614-23073636 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1105806137 13:23952762-23952784 GGTGAAGCCGAGTGGGCTTCTGG - Intergenic
1105851347 13:24339200-24339222 GGTGAAGCCGGTTGCGCTTCTGG + Intergenic
1105952611 13:25244462-25244484 GGTGAGGCCAGCTGGACTTCTGG - Intergenic
1105982717 13:25535217-25535239 GGGGAAGCTGGCTGTCCTTAAGG + Intronic
1106162308 13:27212342-27212364 GGTGAACCCGGCTGGGCTTCTGG + Intergenic
1106163387 13:27219962-27219984 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1106599799 13:31177779-31177801 GGCGAAGCCGGCTGGGCTTCTGG + Intergenic
1106679420 13:31994793-31994815 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1106712304 13:32350864-32350886 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
1106841847 13:33692313-33692335 GGTGAAGCCAGCAGGGCTTCTGG - Intergenic
1106938763 13:34753280-34753302 GGTGAAGCCAACTGGGCTTCTGG + Intergenic
1107012868 13:35685244-35685266 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1107080770 13:36372508-36372530 AGTGAAGATGACTGAGCTTCAGG + Intergenic
1107182064 13:37472633-37472655 GGTGAAGTCAGCTGAGCTTCTGG - Intergenic
1107398211 13:40040942-40040964 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1107690881 13:42951878-42951900 GGTGAAGCCAGCTGGACTTCTGG + Intronic
1107840895 13:44456559-44456581 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1107853734 13:44594615-44594637 GGTGAAGCCCGCTGGGCTTCTGG - Intergenic
1107942540 13:45387481-45387503 GGTGAAGCCAACTGGGCTTCTGG - Intergenic
1108113456 13:47102439-47102461 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1108438505 13:50425356-50425378 GCAGGAGCTGGCTTGGCTTCAGG + Intronic
1108447762 13:50526649-50526671 GGAGAAACAGGCTGTGCTTCTGG + Intronic
1108763055 13:53593412-53593434 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1108817816 13:54313276-54313298 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1108818513 13:54318087-54318109 GGTGAAGCTAGCTGGGCTTCTGG + Intergenic
1108855465 13:54787800-54787822 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1108958267 13:56187825-56187847 TGTGAAGCAGGCTGGGTTTCTGG + Intergenic
1109140431 13:58708014-58708036 GGTGAAGCCTGCTGGGCTTCTGG - Intergenic
1109149198 13:58823620-58823642 GGTGAAGCAGGCTGGGCTTCTGG - Intergenic
1109163838 13:59009165-59009187 GGTGAAGCCAACTGGGCTTCTGG + Intergenic
1109411296 13:61972676-61972698 GGTGAAGCCAGCTGAACTTCTGG - Intergenic
1109429368 13:62212302-62212324 GGTGAAGCTGGCTGGACTTCTGG - Intergenic
1109464499 13:62712018-62712040 TGCAAAGCTGGCTGGGCTTCTGG + Intergenic
1109500679 13:63233603-63233625 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1109503063 13:63263722-63263744 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1109508562 13:63337802-63337824 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1109534072 13:63693705-63693727 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1109674817 13:65662187-65662209 AGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1109867279 13:68281815-68281837 GGTGAAGCCAGCTGGGTTTCTGG - Intergenic
1110079272 13:71290349-71290371 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1110582879 13:77152676-77152698 GCTGGAGACGGCTGGGCTTCAGG + Intronic
1110887658 13:80658723-80658745 TGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1110896432 13:80758411-80758433 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1111096084 13:83517133-83517155 GGCGAAGCCGGCTGGGTTTCTGG + Intergenic
1111197521 13:84894584-84894606 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1111258218 13:85700266-85700288 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1111568658 13:90048862-90048884 GGTGAAGATAGCTGAGATTCAGG + Intergenic
1111710247 13:91802702-91802724 GGTGAAGCTGGCTGGGCTTCCGG - Intronic
1111722544 13:91964679-91964701 GGTGAAGCTGGCTGGGCTTTTGG - Intronic
1112008932 13:95277853-95277875 GGAGAGGGTGGCGGGGCTTCAGG + Intronic
1112369471 13:98782206-98782228 GGTGAAGCAGGCAGAGCCTCAGG + Intergenic
1112635008 13:101207565-101207587 CATGAAGCTGGCTGGGCTTCTGG + Intronic
1112859616 13:103814332-103814354 GGTGAAGTCAGCTGGGCTTCTGG + Intergenic
1112882142 13:104121123-104121145 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1112899089 13:104337620-104337642 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1113208895 13:107951586-107951608 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1113227804 13:108178066-108178088 GGTGAAGCCAGCTGGGTTTCTGG + Intergenic
1113550542 13:111189914-111189936 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1113551892 13:111199085-111199107 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1113859723 13:113473296-113473318 GGTGAAGCTGGGTTGGGCTCTGG - Intronic
1114146208 14:19980738-19980760 GTGGAAGCTGGATGGCCTTCGGG - Intergenic
1114460291 14:22882353-22882375 GGTGCAGCTGCCAGGCCTTCTGG - Intergenic
1114566370 14:23635967-23635989 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1114772196 14:25440641-25440663 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1114785970 14:25599519-25599541 GGTGAAGCTGGCTGGCCTTCTGG + Intergenic
1114793049 14:25681010-25681032 GGTGAAGGCAGCTGGGCTTCTGG - Intergenic
1115057656 14:29150694-29150716 GGTGAAGCCGGCTGCACTTCTGG + Intergenic
1115166063 14:30449734-30449756 GGTGATGCTGGTTTGCCTTCAGG - Intergenic
1115284894 14:31705755-31705777 GGTGAAGCCGTCTGGGCTTCTGG - Intronic
1115285864 14:31712298-31712320 GGTGAAGCCATCTGGGCTTCTGG - Intronic
1116035926 14:39627051-39627073 GCCGGAGATGGCTGGGCTTCAGG + Intergenic
1116083273 14:40203720-40203742 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1116084360 14:40216912-40216934 GGTGAAGCAGGCTGGGCTTCTGG - Intergenic
1116346901 14:43805028-43805050 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1116526347 14:45910543-45910565 GATGGAGATGGCTGGACTTCAGG + Intergenic
1116730464 14:48614960-48614982 GGTGAAGTCGGCTGGGCTTCTGG + Intergenic
1117372032 14:55087299-55087321 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1118392054 14:65303935-65303957 GCTGCAGCTGGCTGGGCTGGGGG - Intergenic
1118489353 14:66244188-66244210 GTTGAAGCTGGTTTGGCCTCAGG - Intergenic
1119117320 14:72036954-72036976 GGTGTAGCCAGCTGGGCTTCTGG + Intronic
1119300470 14:73567340-73567362 GGTGAAGACCGCTGGGCTTCTGG + Intergenic
1120030138 14:79631637-79631659 GGTGAAGCCGGCTGGGCTTTTGG + Intronic
1120101381 14:80449364-80449386 TTTGTAGTTGGCTGGGCTTCGGG + Intergenic
1120198444 14:81512975-81512997 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1120208874 14:81614691-81614713 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1120219015 14:81711941-81711963 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1121287820 14:92750094-92750116 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1122204979 14:100143792-100143814 TCTGGGGCTGGCTGGGCTTCTGG - Exonic
1122792493 14:104190207-104190229 GGAGAAGGAGGCTGGGCTCCAGG + Intergenic
1122865458 14:104601984-104602006 GGTGGAGCCGGCTGGGATGCAGG - Intronic
1122897798 14:104769031-104769053 GGTGAAGCTGGGTGGGGTCAAGG + Intergenic
1123794382 15:23756849-23756871 GGTGAAGCCGGATGGGCTTCTGG + Intergenic
1123805923 15:23873347-23873369 GGTGAAATCAGCTGGGCTTCTGG + Intergenic
1123893328 15:24803007-24803029 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1123903861 15:24903116-24903138 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1123977481 15:25566936-25566958 GGTGAAGCCCGCTGGGCTTCTGG - Intergenic
1124026660 15:25973111-25973133 GGTGAAGCCAGCTGCGCTTCTGG + Intergenic
1124031686 15:26017962-26017984 AGTGAAGCTGACTTGGCTTCTGG - Intergenic
1124034830 15:26045550-26045572 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1124083067 15:26518910-26518932 GGTGAAGCCAGCTGGATTTCTGG - Intergenic
1124111229 15:26790522-26790544 GGTGAAGCTGACTGCGCTTCTGG - Intronic
1124194476 15:27609171-27609193 GGTGAAGGCAGCTGGCCTTCTGG - Intergenic
1124205318 15:27713870-27713892 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1124376861 15:29134009-29134031 GGTCAGGCTGGGTGGGCATCAGG - Intronic
1124595432 15:31088060-31088082 GGTGCAGCCGACTGGGCTTCTGG + Intronic
1124642449 15:31404327-31404349 GGTGAAGTCAGCTGGACTTCTGG + Intronic
1124828971 15:33129117-33129139 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1124860570 15:33436094-33436116 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1124869127 15:33523030-33523052 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1124889482 15:33719017-33719039 AGTGAAGCTTGCTGAGCTACAGG + Intronic
1124938961 15:34200145-34200167 GGTGAAGCCAGCTGGGTTTCTGG - Intronic
1125264550 15:37864078-37864100 GTTGAAGCCAGCTGGGCTTCTGG + Intergenic
1125529026 15:40399410-40399432 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1126187116 15:45841287-45841309 GCCGGAGATGGCTGGGCTTCAGG + Intergenic
1127875155 15:63105783-63105805 GGTGAAGCCGGCTGGGCTTTTGG - Intergenic
1128942752 15:71801959-71801981 AGTGAAGCCAGCTGGACTTCTGG + Intronic
1129157733 15:73729164-73729186 GCTGAGGCTGCCAGGGCTTCTGG - Intergenic
1129293283 15:74584851-74584873 AGTGAAGCTGGCGGGACTCCTGG - Intronic
1129656771 15:77529745-77529767 GGTGGTTATGGCTGGGCTTCAGG + Intergenic
1130161827 15:81409238-81409260 GGTGAAGCCACCTGGACTTCTGG + Intergenic
1130162380 15:81414239-81414261 GGTGGAGCCAGCTGGGCTTCTGG + Intergenic
1130215476 15:81964868-81964890 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1130348510 15:83069614-83069636 GGTGAAGCCAACTGGACTTCTGG - Intergenic
1130826139 15:87548123-87548145 GGAGAAGATGGGTGAGCTTCAGG + Intergenic
1130904264 15:88228785-88228807 GCAGAAGCTGGAGGGGCTTCTGG - Intronic
1130923220 15:88366247-88366269 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1131346621 15:91655586-91655608 GGTGAAGGCAGCTGGACTTCTGG + Intergenic
1131381039 15:91964092-91964114 GGTGAAGCCAGCTGAGCTTCTGG - Intronic
1131481895 15:92789305-92789327 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1131517490 15:93088954-93088976 GGTGGCGCTGGCGGGGCTGCGGG + Intronic
1131572632 15:93554468-93554490 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1131596416 15:93802746-93802768 GGTGAATTTAGCTGGGCTACTGG + Intergenic
1131692040 15:94837660-94837682 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1131710341 15:95047343-95047365 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1131727972 15:95247902-95247924 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1131807304 15:96136141-96136163 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1131807767 15:96140759-96140781 GGTGAAGTCAGCTGGGCTTCTGG - Intergenic
1131895890 15:97028877-97028899 GGTGAAGCTAGCTGGACTTCTGG - Intergenic
1131908782 15:97173038-97173060 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1131913379 15:97234029-97234051 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1131969318 15:97875938-97875960 ACTGAAGCCGGCTGGGCTTCTGG + Intergenic
1132043666 15:98546730-98546752 GGTGAAGCCAGCCGGACTTCTGG - Intergenic
1132592229 16:731063-731085 GGGGAGGCCTGCTGGGCTTCAGG + Intronic
1132670836 16:1101775-1101797 GGTGCCTCTGGCTGGGGTTCCGG - Intergenic
1134903787 16:17961884-17961906 GGTGAAGCCAGCTGGGCTTGTGG + Intergenic
1135224528 16:20644114-20644136 GTTGAAGCCAACTGGGCTTCTGG - Intronic
1135297063 16:21289702-21289724 GTTGAAGCCAGCTGGGCTGCTGG + Intronic
1135338939 16:21630136-21630158 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1135394876 16:22123521-22123543 CGTGTACCTGGGTGGGCTTCAGG - Intronic
1135597672 16:23755927-23755949 GGTGAGGCTTGCTGGGCGTGGGG + Exonic
1136631932 16:31493906-31493928 GGTGAACCTGGCGGGGCTCTTGG - Exonic
1137373243 16:47928348-47928370 GGTAAAGCTGGCTGGGCTTCTGG - Intergenic
1137375801 16:47950714-47950736 GGTGAAGCCAGCTGGGCTTCCGG + Intergenic
1137573348 16:49580924-49580946 GGTGGGCCTGGCTGGGCCTCGGG - Intronic
1137876070 16:51997757-51997779 GGTGAAGGCAGCTGGGCTTCTGG + Intergenic
1137959547 16:52868501-52868523 GGTGAAGCCAGCTGAACTTCTGG + Intergenic
1138536009 16:57660638-57660660 GATGGGGCTGGGTGGGCTTCAGG + Intronic
1138548795 16:57735917-57735939 GGCGGGGCTGGCTGGGCTTGCGG + Intronic
1138631286 16:58296002-58296024 GGTGAAGCCGGCAGGACATCAGG - Intronic
1138643108 16:58401674-58401696 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1138657827 16:58501011-58501033 CGTGAAGCTGGCAGGGCTAGGGG + Intronic
1138743191 16:59334202-59334224 GGTTAAGCTGGCTGGGCTTCTGG - Intergenic
1138775405 16:59716928-59716950 AGTGAACCTAGCAGGGCTTCTGG - Intronic
1138877711 16:60973260-60973282 CGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1139088492 16:63617283-63617305 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1139654417 16:68378658-68378680 AGTGCAGCAGGGTGGGCTTCAGG - Intronic
1139915845 16:70428043-70428065 GGTCTGGCTGGCTGGGCTGCAGG + Intronic
1141561130 16:84868408-84868430 GGTGAGCCTGGCTGGGTCTCCGG + Intronic
1141650917 16:85392765-85392787 GGTCAAGGAGGCTGGACTTCTGG - Intergenic
1141935407 16:87235076-87235098 CGTGAGGCTGTCTGGGTTTCTGG + Intronic
1142174141 16:88637229-88637251 GGTGAGGCTGGCTGGGGGTGGGG - Intergenic
1142328601 16:89435026-89435048 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1142698137 17:1644707-1644729 AGTGAAGCTGGGGGGGATTCTGG + Intronic
1142850008 17:2700242-2700264 GGAGACGCTGACTGGCCTTCGGG + Intronic
1143060354 17:4195542-4195564 GGTGATTCTGCCTGGGATTCTGG - Intronic
1143530171 17:7498171-7498193 GGTGAAGGTCACTGGGCTTGGGG - Exonic
1143800513 17:9376118-9376140 GGTGAAGCCGGCTGGACTTCTGG + Intronic
1144011399 17:11151540-11151562 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1144130210 17:12239437-12239459 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1144263793 17:13548613-13548635 GGTGAAGCTGACTGGGCTTCTGG + Intronic
1144394874 17:14834327-14834349 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1144709450 17:17391562-17391584 GGTGAAGCCGGTTGGGCTTCTGG + Intergenic
1144748616 17:17633182-17633204 CGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1144939605 17:18928981-18929003 GGTACAGCTGCCTGGGCTTTTGG + Intronic
1145220622 17:21085674-21085696 GGTGAAGTCGGCTGGGCTTCTGG - Intergenic
1146299318 17:31676090-31676112 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1146306225 17:31731602-31731624 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1146319162 17:31833093-31833115 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1146527586 17:33580074-33580096 CGTGAAGCCAGCTGGCCTTCTGG - Intronic
1147404026 17:40197902-40197924 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1148736899 17:49870030-49870052 GGGCAAGCTGGCTGGGCCGCAGG + Intergenic
1148800184 17:50220338-50220360 GGAGAAGCTCTCTGAGCTTCTGG - Intergenic
1149342604 17:55702028-55702050 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1149674512 17:58447305-58447327 GGTGAAGCTGGCTGGGACTTGGG - Intronic
1149867418 17:60158416-60158438 TGTGAAGCTGAATGGGCTCCCGG - Exonic
1149972930 17:61237103-61237125 GGTGAAGCCAGCTGGACTTCTGG + Intronic
1149977777 17:61284006-61284028 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1150744012 17:67801794-67801816 GGTGAAACTGGCCAGGCTGCGGG - Intergenic
1151028107 17:70703653-70703675 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1151355065 17:73553483-73553505 GGTGCAGCCGGCAGGGCTTGGGG - Intronic
1151358654 17:73575170-73575192 GCTGAAGCTCCCTGGGCTCCAGG + Intronic
1151588275 17:75025092-75025114 GGTGAAGCCGACTGGGCTTCTGG + Intergenic
1151603348 17:75120188-75120210 GGTGATGCTGGCCGGGCGTGGGG - Intronic
1151757236 17:76081934-76081956 TGTGCTGCTGGCTGGGCTGCTGG + Exonic
1152230998 17:79114164-79114186 GGTGAACCCGGCTTGGCTCCTGG + Intronic
1152658157 17:81529515-81529537 GGTGTAGGTGGGTGGGCCTCGGG + Intronic
1152773832 17:82187666-82187688 GGGGAAGCTGGCAGGGGTTGCGG + Intronic
1153004458 18:484929-484951 GGTAAAGCTGGTGGGGCTTGTGG + Intronic
1153071961 18:1116375-1116397 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1153413060 18:4815726-4815748 GGTGAAGCTGGCTGGGCTTTTGG + Intergenic
1153431209 18:5019265-5019287 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1153433789 18:5047543-5047565 GGTGAAGCTGGCTGGTCTTCTGG + Intergenic
1153437671 18:5085235-5085257 GGGGAAGCCAGCTGGGCTTCTGG + Intergenic
1153438408 18:5090482-5090504 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1153646563 18:7201195-7201217 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1153934851 18:9912645-9912667 GGTGAAGCCAGCTGGATTTCTGG - Intergenic
1155824247 18:30419384-30419406 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1156118918 18:33820086-33820108 GGTGAAGCTGGCTGGGCTTTTGG - Intergenic
1156324772 18:36064388-36064410 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1156735002 18:40245583-40245605 GGTGAAGCCGGCCGGGCTTCTGG + Intergenic
1156764515 18:40635391-40635413 GGTGAAGCCAGTTGGACTTCTGG - Intergenic
1157484834 18:48079598-48079620 GATGAAGCTGGCTGGGCTTTAGG + Intronic
1157655390 18:49382532-49382554 GTTGAAGCTGAATGAGCTTCGGG + Intronic
1157692421 18:49694461-49694483 GCTGCAGCCTGCTGGGCTTCAGG - Intergenic
1157741451 18:50096934-50096956 GGTGAGGCTGGCAGGTCTGCTGG - Intronic
1158603975 18:58878560-58878582 GGTGAAGTTGGCTCCACTTCAGG - Intronic
1158744181 18:60178630-60178652 GGTGAAGCCGGCTGGGCATCTGG - Intergenic
1158764786 18:60436786-60436808 GATGCAGCTGGCTAGCCTTCTGG + Intergenic
1158811917 18:61047577-61047599 GATGAAGCCAGCTGGACTTCTGG + Intergenic
1159346684 18:67215682-67215704 GGTGAAGCTGGTTGGGCTTCTGG - Intergenic
1159400396 18:67924882-67924904 AGTGAAGCTAGCTGAGGTTCAGG - Intergenic
1160507876 18:79437371-79437393 GCTGAGGCTGGCTGCGCTGCTGG - Intronic
1160822948 19:1066826-1066848 GGTGGAGCGGGCTTGCCTTCAGG + Intronic
1161720134 19:5897854-5897876 GGTGAAGCTGGGCGGGCTCTGGG - Intronic
1162107547 19:8379166-8379188 GGTGAAGCCGGCTAGGCTTCTGG + Intronic
1162205562 19:9053600-9053622 GGTGAAGCCCGCTGGGCTTCTGG + Intergenic
1164674474 19:30092235-30092257 GGTGAAGCCCCCTGAGCTTCAGG + Intergenic
1164698561 19:30265278-30265300 GTTGAAGAGGGCTGGGCTCCTGG - Intronic
1164700487 19:30280947-30280969 AGTGAACATGGCTGGGCTGCTGG + Intronic
1165046140 19:33106526-33106548 GGGGATGCTGGCTGGACCTCTGG + Intronic
1165068134 19:33240788-33240810 GGGGAAGCTGGCAGGGCCTCGGG - Intergenic
1165267785 19:34676270-34676292 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1166135070 19:40771683-40771705 GGTGAAGATGGCTGGGCCTCTGG - Exonic
1167504730 19:49865269-49865291 GGAGTATCTGGCTGGGATTCTGG + Exonic
1167655138 19:50758843-50758865 GGGCGAGCTGGCTGGCCTTCGGG + Intergenic
1167781044 19:51598984-51599006 GATGAAGCTGGCTGGGCTTCTGG + Intergenic
1167790554 19:51676242-51676264 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1167994497 19:53391432-53391454 GGTTAAGCCGGCTGGGCTTCTGG - Intronic
1168078506 19:53992991-53993013 GGTGAAGCTGGCGCTGCTGCTGG + Exonic
1168701629 19:58443363-58443385 AGTGAAGCCGGCTGGGCTTCTGG - Intergenic
925228445 2:2207428-2207450 GGTGAGGCTGGCCTGGGTTCAGG - Intronic
925393811 2:3518574-3518596 GGTGGAGCTGGCTTGGGTCCCGG - Intronic
925949239 2:8895604-8895626 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
925950314 2:8903223-8903245 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
926083329 2:10006239-10006261 GGTGAAGCGGGCTGGGCTGCCGG - Intergenic
926468905 2:13228067-13228089 GCTGGAGATGGCCGGGCTTCAGG - Intergenic
926603544 2:14873311-14873333 GGTGAAGCGAGTTGGGCTTCTGG - Intergenic
926792840 2:16592530-16592552 AGTGAAGGTGTCTGGGCATCTGG + Intronic
927137327 2:20106600-20106622 GATGAAGCCGGCTGGGCTTCTGG - Intergenic
927379741 2:22465187-22465209 GGTGATGCCGGCTGGGATTTGGG - Intergenic
927759171 2:25736226-25736248 GTTGAAGCTGCCTTGTCTTCTGG + Intronic
927777876 2:25915905-25915927 GGTGAAGCCAGCTGGGCTCCTGG + Intergenic
927970953 2:27306231-27306253 GGTGGAGCTGGCAGGGCGGCCGG + Exonic
928106735 2:28475390-28475412 GGTGAGGCCAGCTGGACTTCCGG - Intronic
928599110 2:32886489-32886511 GGGGAAGCCAGCTGGGCTCCTGG - Intergenic
928690897 2:33797504-33797526 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
928697495 2:33863967-33863989 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
928793881 2:34992250-34992272 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
930681773 2:54264450-54264472 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
930697067 2:54422672-54422694 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
931412059 2:62042393-62042415 GGTAAAGCCGGCTGGGCTTCTGG - Intronic
931470742 2:62535914-62535936 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
931540083 2:63322011-63322033 GGTGAAGCCAGCTGGGTTTCTGG + Intronic
931540927 2:63328059-63328081 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
933067468 2:77815798-77815820 GGTGAAGCCCGCTGGGCTTCTGG - Intergenic
933341805 2:81035131-81035153 GGTGAAGCCAGCTGGAATTCTGG + Intergenic
933342508 2:81040260-81040282 GGTGAAGCCAGTGGGGCTTCTGG + Intergenic
933463662 2:82622179-82622201 GGTGAAGCTGGCTGGGGACTTGG + Intergenic
933489501 2:82967599-82967621 CGTGAAGCCAGCTGGACTTCTGG - Intergenic
933505995 2:83177794-83177816 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
933581075 2:84127786-84127808 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
934583339 2:95465572-95465594 GGTGAAGCCAGTTGGGCTTCTGG + Intergenic
934596111 2:95611142-95611164 GGTGAAGCCAGTTGGGCTTCTGG - Intergenic
934786666 2:97014372-97014394 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
935223698 2:101035820-101035842 GGTCAGGCTGCCTGGGCCTCTGG - Intronic
935248026 2:101236223-101236245 GGTGAAGCCAGCTGAACTTCTGG + Intronic
935559449 2:104545170-104545192 GGTGGAGCAGGCTGGGCTCCAGG + Intergenic
935762428 2:106333836-106333858 AGTGAAGCCAGCTGGGCTTCTGG - Intergenic
936076554 2:109405113-109405135 GGTGACGTTGGCTGGGGTTCTGG - Intronic
936631401 2:114207025-114207047 GGTGAACCCAGCTGGGCTTCTGG + Intergenic
937684162 2:124677836-124677858 GGTGAAGCCAGGTGGGCTTCTGG - Intronic
937716347 2:125037576-125037598 AGTGAAACTGGCTGGGCTTCTGG + Intergenic
937763309 2:125631363-125631385 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
937766386 2:125665367-125665389 GATGAAGCCAGCTAGGCTTCTGG - Intergenic
937771852 2:125728583-125728605 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
937908718 2:127065101-127065123 GGGACAGCTGGCTGGGCTTGGGG - Intronic
937952680 2:127400920-127400942 GGTGAAGCGGGCAGGACTGCGGG - Intergenic
937960854 2:127457165-127457187 GGTGAAGCACGGTGGGCTGCGGG + Intronic
937990626 2:127660054-127660076 GGGGAAGCTGGCTGGGCTTCTGG + Intronic
938038221 2:128054084-128054106 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
938119118 2:128621403-128621425 GCTTCAGCTTGCTGGGCTTCAGG - Intergenic
938151119 2:128883776-128883798 GGTGAAGCCAGATGAGCTTCAGG - Intergenic
938153119 2:128903679-128903701 GGTGAGGTTGGCTGGGCTTCTGG - Intergenic
938177165 2:129144404-129144426 GGTGTAGCCGGCTGGGCTTCTGG - Intergenic
938315957 2:130328074-130328096 GGTGAAGCCTGCTGGGCTTCTGG + Intergenic
938512643 2:131966716-131966738 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
938805583 2:134804476-134804498 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
938806563 2:134811622-134811644 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
939255843 2:139743931-139743953 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
940264710 2:151824553-151824575 GGAGAAGCTGCCTGTGCTTCAGG - Intronic
940485552 2:154291459-154291481 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
941243055 2:163066524-163066546 GGTGAAACCATCTGGGCTTCTGG + Intergenic
941243868 2:163072734-163072756 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
941272668 2:163450254-163450276 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
941537196 2:166739011-166739033 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
941537931 2:166744500-166744522 GGTGAAGACAGCTGGGCTTCTGG - Intergenic
942101772 2:172590892-172590914 GGTGAAGCCAGTTGGGCTTCTGG - Intronic
942106480 2:172638597-172638619 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
942673720 2:178404651-178404673 GTTGAAGCAGGCTGGTCTTCAGG - Intergenic
942902992 2:181145628-181145650 GATGAAGCCGGCTGGGCTTTTGG - Intergenic
943086301 2:183315699-183315721 TGTGAAGCTGACTCAGCTTCAGG - Intergenic
943102710 2:183507877-183507899 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
943103430 2:183513136-183513158 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
943211506 2:184973398-184973420 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
943744540 2:191448029-191448051 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
943855087 2:192779160-192779182 GGTGAAGCCAGCGGAGCTTCTGG - Intergenic
943868393 2:192959013-192959035 GGTGAAGCTGGCTGGGCTCCTGG - Intergenic
943899387 2:193412703-193412725 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
943902373 2:193456379-193456401 GGTGAAGCCAGTTGGGCTTCTGG + Intergenic
944237152 2:197450904-197450926 GGTGAAGCCGGCTGGACTTCCGG + Intergenic
944358606 2:198823534-198823556 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
944362172 2:198869993-198870015 AGTGAAGCTGGCTGGGCGTCTGG - Intergenic
944688199 2:202136510-202136532 GGTGAAGCCTACTGGGCTTCTGG - Intronic
944812800 2:203344636-203344658 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
945056604 2:205874678-205874700 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
945444952 2:209925797-209925819 GGTGAAGCCAGCTGATCTTCTGG - Intronic
945471149 2:210229043-210229065 GCTGAAGATGGCTGGGCTTCAGG - Intergenic
946206011 2:218109233-218109255 GGTGAAGCTAGCTGGGCTTTTGG - Intergenic
947095837 2:226565809-226565831 GGTGAAGTTGGCTAGCCTTAGGG - Intergenic
947316035 2:228859529-228859551 GGTGCAGCTGCCTGTGCTTATGG - Intronic
947539286 2:230964181-230964203 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
947588564 2:231371565-231371587 CGGGAAGCTGGCTGGTCCTCCGG - Intronic
948306302 2:236949519-236949541 AGTGAAGCTTGCTGGTCTTGGGG - Intergenic
948510190 2:238458828-238458850 GCTGGAGCAGGCTGGGCTCCCGG + Intergenic
948545106 2:238722768-238722790 GGTGAAGCCAGCTGGGCTTCCGG - Intergenic
948643390 2:239389019-239389041 GGTGAAGCCAGCTGGACTTCTGG + Intronic
948689220 2:239691467-239691489 GGCGAAGCTGCTTGAGCTTCAGG + Intergenic
948706917 2:239800528-239800550 GGTGAAGCCAGCTGTGCTTCTGG + Exonic
948817853 2:240522259-240522281 GGTGAAGCCAGCTGAGCTTCTGG - Intronic
949040095 2:241844076-241844098 GGTGGAGCTGGCCGGGCTCAGGG + Intergenic
1170115734 20:12857595-12857617 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1170215144 20:13883584-13883606 GGAGATCCTGGCTGGGCTCCTGG + Intronic
1171137664 20:22711396-22711418 TGTGAAGCATGCTGGGCTCCTGG + Intergenic
1171171761 20:23021760-23021782 GGTGAGGCTGCCTGGACTTAGGG - Intergenic
1171261156 20:23735756-23735778 GGTGAAGACAGCTAGGCTTCTGG + Intergenic
1171261976 20:23742109-23742131 GGTGAAGCCAGCTAGGCTTCTGG + Intergenic
1171270283 20:23811598-23811620 GGTGAAGACAGCTAGGCTTCTGG + Intergenic
1171271080 20:23817839-23817861 GGTGAAGCCAGCTAGGCTTCTGG + Intergenic
1171398899 20:24859039-24859061 GGTGAAGCCAGCTGGCCTTCTGG - Intergenic
1172197655 20:33103092-33103114 TGTGAGGCTGGCTGGGCATGGGG + Intronic
1172229049 20:33324726-33324748 TGAGACCCTGGCTGGGCTTCTGG - Intergenic
1172317259 20:33965602-33965624 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1172346553 20:34205932-34205954 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
1172491906 20:35345994-35346016 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1172642542 20:36449471-36449493 GGAGAGGCTGGCAGGGCTACCGG - Intronic
1173334558 20:42102041-42102063 GGTGGAGGTGGCTGGACCTCAGG - Intronic
1173488072 20:43456242-43456264 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1174305365 20:49611002-49611024 GGTGGAGCTGGCTGCCCTTAAGG + Intergenic
1174645882 20:52085027-52085049 GGTGCAGCCGGCTGTGCTCCAGG + Intronic
1175251041 20:57610426-57610448 GGTGAACCAGGCTGGGGGTCAGG - Intronic
1175309048 20:57998796-57998818 GGGGCAGCTGGAAGGGCTTCCGG + Intergenic
1175868317 20:62193504-62193526 GCAGTAGCCGGCTGGGCTTCAGG - Exonic
1176781123 21:13196077-13196099 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1177371110 21:20204939-20204961 GGTGAAGCTGGCTGGACTTCTGG + Intergenic
1177385424 21:20403702-20403724 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1177492426 21:21844970-21844992 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1177497630 21:21910258-21910280 GGTGACACCAGCTGGGCTTCTGG - Intergenic
1177565749 21:22818775-22818797 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
1177691159 21:24509561-24509583 GATGAAGCCAGCTGGACTTCTGG + Intergenic
1177715953 21:24840241-24840263 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1177978813 21:27885229-27885251 GGTGAAACCGGCTGGGCTTCTGG - Intergenic
1178041209 21:28642701-28642723 GCCGGAGATGGCTGGGCTTCAGG - Intergenic
1178109400 21:29355437-29355459 GGTGAAGCCAGCTGGCCTTCTGG - Intronic
1178259243 21:31083644-31083666 GGTGAAGCTGGCTGGGCCTCTGG - Intergenic
1178473484 21:32916407-32916429 GGTGCAGATGGCTGGAGTTCTGG + Intergenic
1179347901 21:40578283-40578305 GGTGAAGTCAGTTGGGCTTCTGG + Intronic
1179427402 21:41292592-41292614 GATGAAGCCAGCTGGGCTTCTGG + Intergenic
1179523636 21:41961563-41961585 GCTGGAGCTGGCAGAGCTTCTGG - Intergenic
1179895428 21:44359309-44359331 GGTGAAGCCAGCTAGACTTCTGG - Intronic
1180049652 21:45325379-45325401 GGTGTAGGTGGCTGGGCCACAGG - Intergenic
1180186564 21:46143019-46143041 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
1180656746 22:17427839-17427861 GATGAAGCCAGCTGGGCTTCTGG - Intronic
1180753240 22:18140859-18140881 GGCAAAGCCAGCTGGGCTTCTGG + Intronic
1180918532 22:19506273-19506295 GGTGGAGCTGGCTGAACTCCTGG + Intronic
1181120394 22:20664143-20664165 GGTGAAGCTGGCCAGGGTTTAGG + Intergenic
1181407793 22:22697281-22697303 GGAGCAGCTGGCTTGGGTTCAGG + Intergenic
1181450114 22:23014148-23014170 GCTGGAGATGGCTGGGCTTCAGG - Intergenic
1181981049 22:26766776-26766798 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1182830391 22:33300304-33300326 AGTGCAGCTGGCAGGGTTTCTGG + Intronic
1183048349 22:35240339-35240361 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1183315852 22:37136472-37136494 GGTGCAGCTGGCAGGGGTTGGGG - Intronic
1183540391 22:38426469-38426491 GGGGAAGGTGGCTGGACTGCTGG - Exonic
1183680826 22:39328251-39328273 GGTGATGCTGGCTGGCCAGCGGG + Intergenic
1184415585 22:44350172-44350194 CGGGCAGCTGGCTGGGCTGCTGG - Intergenic
1184690175 22:46113872-46113894 GCCGAAGCTGGGTGGGCATCTGG + Intronic
1184825812 22:46950067-46950089 GGAGAAGCTGGGTGGACTCCAGG + Intronic
949133587 3:535933-535955 AGCGAAGCCGGCTGGGCTTCTGG - Intergenic
949207304 3:1455329-1455351 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
949648528 3:6127503-6127525 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
949723217 3:7014810-7014832 GGTGAAGCCAGCTGGACTTCTGG + Intronic
949741345 3:7238025-7238047 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
949790876 3:7790830-7790852 GGTGAAGCCAGCTAGACTTCTGG - Intergenic
950205290 3:11075619-11075641 GGTGAAGCTGACTGCGCTTCCGG - Intergenic
950556226 3:13697644-13697666 GGGGAAGCTGGCTGGGCTCTGGG + Intergenic
950838315 3:15941881-15941903 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
951173290 3:19568457-19568479 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
951239086 3:20269434-20269456 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
951239967 3:20275737-20275759 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
951525457 3:23648610-23648632 GGGGAAGGTTGCTGGGCTTCTGG + Intergenic
952365829 3:32674100-32674122 TGTTAAGCCAGCTGGGCTTCCGG - Intergenic
952535491 3:34304937-34304959 GGTGAAGCCGGCTGCACTTCTGG + Intergenic
952940293 3:38439078-38439100 GGTGAAGCCAGTTGGACTTCTGG - Intergenic
953064774 3:39458957-39458979 CATGAAGCCAGCTGGGCTTCTGG - Intergenic
953098460 3:39802511-39802533 GGTGAAGCTGGCTTGGCTTCTGG + Intergenic
953582894 3:44173172-44173194 GGTGAAGCTGGATGGGCTTCTGG - Intergenic
954105841 3:48409544-48409566 GGTGGAGCTGGGTGGGCTCTAGG - Intronic
954210466 3:49094166-49094188 GGGGAAGGTGGCCGCGCTTCTGG + Exonic
954367029 3:50151693-50151715 GGTGGACCTGGCTGAGCTTCAGG - Intergenic
954483726 3:50826435-50826457 GGTGAAGCTTGCTGACCTTATGG - Intronic
954598549 3:51849808-51849830 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
954599410 3:51856249-51856271 AGTGAAGCCAGCTGGGCTTCTGG + Intergenic
954676049 3:52315938-52315960 AGTGGAGCTGGCAGGGCTGCTGG + Intergenic
954792317 3:53142497-53142519 GGTGAAGCAGGCTGAGCTCTTGG - Intergenic
955160524 3:56461181-56461203 GGACAAGCTGGCCAGGCTTCAGG + Intronic
955417796 3:58708882-58708904 AGTGAAGCTGGCTGGGCTTCTGG + Intergenic
955725177 3:61925421-61925443 GGAGAAGTTTGCTGGGCTTCCGG - Intronic
956035960 3:65092285-65092307 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
956563708 3:70612257-70612279 GGTGAAGCCAGCTGGGCTCCTGG + Intergenic
956842461 3:73153395-73153417 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
957037596 3:75309283-75309305 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
957271026 3:78030132-78030154 GGTGAAGCAGGCTGGGCTTCTGG + Intergenic
957510397 3:81180693-81180715 GGTGAAGCCGACTGGGCATCTGG + Intergenic
957510605 3:81182915-81182937 GGTGAAGCCGGCTTGGCTTCTGG - Intergenic
957782345 3:84835387-84835409 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
958457341 3:94348270-94348292 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
958601009 3:96297551-96297573 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
958601693 3:96302540-96302562 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
959236385 3:103727832-103727854 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
959247963 3:103899662-103899684 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
959491784 3:106998843-106998865 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
959882105 3:111455693-111455715 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
960227452 3:115184805-115184827 GGTGAAGCCAGCTGGGTTCCTGG - Intergenic
960295680 3:115940508-115940530 GGTGAAGCCAGCTGAGCTTCTGG - Intronic
960434542 3:117609599-117609621 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
960585240 3:119315016-119315038 GCTGAAGCTGTCAGGGCTTGGGG - Intronic
960587967 3:119337898-119337920 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
961584832 3:127913866-127913888 GGTGAAGCCAGCTGCACTTCTGG + Intergenic
961788217 3:129360135-129360157 CGTGGAGCTGAGTGGGCTTCAGG - Intergenic
962106642 3:132396622-132396644 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
962177403 3:133168468-133168490 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
962238737 3:133732231-133732253 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
962285807 3:134084829-134084851 GGTGAGGCTGGCTCAGCTGCTGG - Intronic
962297024 3:134199778-134199800 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
962362568 3:134754487-134754509 GGGGATGCTGTCTGGGCTTATGG + Intronic
962887328 3:139639551-139639573 GGAGAAGATCCCTGGGCTTCAGG - Intronic
963020874 3:140872020-140872042 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
963021725 3:140878375-140878397 AGTGAAGCCAGCTGGACTTCTGG + Intergenic
963034885 3:141017314-141017336 GGGGAAGCCGGCTGGGCTTTTGG + Intergenic
963692763 3:148525443-148525465 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
963700298 3:148617789-148617811 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
963992674 3:151671254-151671276 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
964184321 3:153924427-153924449 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
964240317 3:154585362-154585384 GGTGACTCTGGGTGGGCTCCTGG + Intergenic
964555054 3:157927785-157927807 AGTGAAGCTGGCTGGGCTTCTGG - Intergenic
964954629 3:162337158-162337180 AGTGAAGGTGGCTGGGCTTCTGG - Intergenic
964971882 3:162574432-162574454 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
965102147 3:164311374-164311396 GGCGAAGCTGGCTGGGCTTCTGG - Intergenic
965139268 3:164814452-164814474 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
965139878 3:164818676-164818698 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
966290413 3:178349554-178349576 GGTGAGGCCAGCTGGGCTTCTGG - Intergenic
966430428 3:179826481-179826503 GCTGAAGCTTTCTGTGCTTCAGG + Intronic
966812558 3:183860154-183860176 AGTGAAGTTGGCTCAGCTTCTGG - Intronic
967477231 3:189935995-189936017 CATGAAGCCAGCTGGGCTTCTGG - Intergenic
967541847 3:190677880-190677902 AGTGAAGCCAGCTGGGCTCCTGG + Intergenic
967583265 3:191185386-191185408 GAAGAAGCTGGCTGGGCTTCTGG + Intergenic
967584241 3:191192257-191192279 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
967950995 3:194840451-194840473 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
968612810 4:1564732-1564754 GATGCAGCTGGCTGGGCTGGGGG + Intergenic
968702128 4:2062176-2062198 GGGGTAGCTGGCAGGGCTGCAGG + Intronic
969021749 4:4143746-4143768 GGTTAAGCTGGCGGTGCTGCTGG - Intergenic
969045170 4:4331365-4331387 GGTGGTTCTGGCTGGGCTGCAGG + Intergenic
969047704 4:4349119-4349141 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
969257452 4:6011847-6011869 GGAGAAGCTGGCGGCGCTGCAGG - Intergenic
969612695 4:8236076-8236098 GGTGTAGCTGGATGGGCCTCAGG + Intronic
969781752 4:9409767-9409789 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
970150667 4:13086468-13086490 GGGGAAGATGGCTGAGCTTCTGG - Intergenic
970363542 4:15334741-15334763 GATGAAGCTACCTGGGTTTCAGG + Intergenic
970700478 4:18730918-18730940 GGTGAAGCTAGCTGGGCCTTTGG - Intergenic
970783714 4:19770726-19770748 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
971209107 4:24599244-24599266 GGCGAAGCCAGCTGGGCTCCTGG - Intergenic
971322096 4:25613941-25613963 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
971696583 4:29912149-29912171 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
971793848 4:31201701-31201723 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
971798602 4:31259559-31259581 GGTGAAGCCAGCTAGGCTTCTGG + Intergenic
971891039 4:32522107-32522129 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
971985952 4:33824191-33824213 GCTGAAGCTGGCAGGACATCTGG + Intergenic
972784612 4:42315220-42315242 GGTGAAGCCGGCTGGACTTCTGG - Intergenic
972790874 4:42369842-42369864 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
972791342 4:42374094-42374116 GATGAAGCCAGCTGGGCTTCTGG - Intergenic
973044634 4:45520272-45520294 GGTGAAGCTAGCTGGGCTTCTGG - Intergenic
973136025 4:46708083-46708105 GGTGAAGCTGGTGGGGTTTCTGG - Intergenic
973908285 4:55552380-55552402 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
974159942 4:58125326-58125348 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
974480105 4:62431864-62431886 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
974526159 4:63052523-63052545 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
974527447 4:63061751-63061773 AGTGATGCAGGCTGGGCTTCTGG + Intergenic
974537842 4:63192456-63192478 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
974679873 4:65146997-65147019 GTGGAAGCTGCCAGGGCTTCTGG + Intergenic
975033885 4:69658095-69658117 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
975208309 4:71669665-71669687 GGTGAAGCCTGCTTGGCTTCTGG + Intergenic
975387138 4:73770600-73770622 GCTGAACATGGCTGGACTTCAGG + Intergenic
975749772 4:77510715-77510737 GGAGAAGCTGTCTGTGCCTCGGG + Intergenic
976182899 4:82415833-82415855 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
976481651 4:85553679-85553701 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
976501621 4:85797008-85797030 GGAGAAGCTGCCTGTGCTGCAGG + Intronic
976596976 4:86904064-86904086 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
976724969 4:88206916-88206938 GATGAAGCTGGCTGGGCTTCTGG - Intronic
976741450 4:88361228-88361250 GGTGAAGCCGGCTGGGCTTTTGG + Intergenic
976862357 4:89680619-89680641 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
977081625 4:92536397-92536419 GGTGAAGCCGGCTGGGTTTCTGG - Intronic
977155738 4:93570832-93570854 GCTGTAGATGGCTGGGCATCAGG + Intronic
977370268 4:96126243-96126265 GGTGAAGCCGCCTGGGATTCTGG - Intergenic
977640604 4:99354250-99354272 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
977640768 4:99355701-99355723 GATGAAGCCAGCTGGGCTTCTGG + Intergenic
977821595 4:101478310-101478332 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
977834351 4:101631517-101631539 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
977835272 4:101638403-101638425 GGTGAAACTGGCTGGGCTTCTGG - Intronic
978409955 4:108415879-108415901 TGTGCTGCTGGCTGGGCTGCTGG + Intergenic
978492220 4:109321647-109321669 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
978944727 4:114481864-114481886 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
979031861 4:115658675-115658697 GGTGAAGCTGGCTGAGATAAGGG + Intergenic
979184358 4:117770422-117770444 GCTGGAGATGGCTGGACTTCAGG + Intergenic
979281936 4:118878467-118878489 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
979307333 4:119162286-119162308 GGTGAGGCTGGACGGGCTTAAGG + Intronic
979613839 4:122719150-122719172 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
979780970 4:124650940-124650962 GGTGAAGCCGGCGGGGCTTCTGG + Intergenic
979780977 4:124650968-124650990 GGTGAAGCCGGCGGGGCTTCTGG + Intergenic
979780983 4:124650996-124651018 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
979903665 4:126256015-126256037 GGTGAAGCTGTCTGGGCTCTGGG - Intergenic
979953305 4:126922393-126922415 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
980122428 4:128741720-128741742 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
980243218 4:130203172-130203194 GGTGAAACCAGCTGGGCTTCTGG - Intergenic
980655156 4:135773323-135773345 GGTGAAGCCGGCTGGGCTTTGGG + Intergenic
980655304 4:135775063-135775085 GGTGAAGCTGGCTGGGCTCCTGG - Intergenic
980690048 4:136284025-136284047 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
980712982 4:136594510-136594532 AGTGAAGCCAGCTGGGCTTCTGG + Intergenic
980760198 4:137222834-137222856 GGTGAAGCCAGCTGGCCTTCCGG + Intergenic
981170351 4:141615805-141615827 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
981726190 4:147849935-147849957 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
982024366 4:151236433-151236455 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
982036782 4:151353745-151353767 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
982112586 4:152070502-152070524 AGTAAAGCTGCCTGGGCTTTGGG + Intergenic
982441318 4:155439748-155439770 GGTGGAGCCGGCTGGGCTTCTGG + Intergenic
982583616 4:157209569-157209591 GGTGAAGCTGGCTGGGCTTCTGG - Intronic
982630256 4:157822183-157822205 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
982700731 4:158657692-158657714 GGTGAAGCTGGCTAGGCTTCTGG + Intergenic
982701794 4:158665145-158665167 GGTGAAGCCGGCTAGGCTTCTGG + Intergenic
982773714 4:159421101-159421123 GGGGAAGCTGGCTGGGCTACTGG + Intergenic
982863474 4:160482212-160482234 GGTGAAGCCAGCTGGGCTCCTGG + Intergenic
982876918 4:160662157-160662179 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
982877625 4:160667343-160667365 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
983006719 4:162493269-162493291 GCTGAAGCAGGCTGGGATGCAGG - Intergenic
983014863 4:162600613-162600635 GTTGAAGCTGGCTGGGCTTCTGG - Intergenic
983084662 4:163428122-163428144 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
983646488 4:169996770-169996792 CGTGAAGCAGGCGGGGCTCCAGG - Intronic
983736970 4:171073591-171073613 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
983922313 4:173359186-173359208 GGTGAATCTGTCTGGGCTTCTGG + Intergenic
983957795 4:173717623-173717645 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
984095515 4:175428147-175428169 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
984266166 4:177499876-177499898 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
984324220 4:178231116-178231138 GGTGAAGGCAGCGGGGCTTCTGG + Intergenic
984404607 4:179311805-179311827 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
984409581 4:179379186-179379208 GGTGAAGCCAGCTGGACGTCTGG - Intergenic
984802200 4:183725584-183725606 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
984939007 4:184915460-184915482 GGTGAAGCCAACTGGGCTTCTGG - Intergenic
985278755 4:188266617-188266639 GGTGAAGGGGGATGGGCATCAGG - Intergenic
985312316 4:188615881-188615903 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
985322957 4:188735066-188735088 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
985423519 4:189807032-189807054 GGTGAAGCCAGCTGGGCTTCCGG - Intergenic
985437056 4:189940667-189940689 GCTGACGGTGGCTGGGCTGCCGG - Intergenic
985560331 5:582809-582831 AGTGAAGCTGCCTGGGCTTCTGG - Intergenic
985657207 5:1138491-1138513 GGTGAAGCCCGCTGGGCCTCTGG - Intergenic
985702178 5:1380323-1380345 GGTGAGGCCGGCTGGGCTTCTGG - Intergenic
985907806 5:2854723-2854745 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
986362850 5:6998389-6998411 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
986540650 5:8840752-8840774 GATGATGCCGGCTGGGCTTCTGG + Intergenic
987346748 5:16985646-16985668 GGTGAAGCAGGCAGGGCTTCTGG - Intergenic
987545641 5:19307712-19307734 GGTGAAGCTGTCTGGGCTTCAGG - Intergenic
987641090 5:20613403-20613425 GGCGAAGCCAGCTGGGCTTCTGG - Intergenic
987676645 5:21083213-21083235 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
987747459 5:21994702-21994724 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
987923254 5:24310326-24310348 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
987923720 5:24314618-24314640 AGTGAAGCCTGCTGGGCTTCTGG + Intergenic
988036195 5:25830332-25830354 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
988113383 5:26852495-26852517 TATGAAGCTGGCTGGGCTTCTGG + Intergenic
988156722 5:27462892-27462914 AGTGAAGCCAGCTGGGATTCTGG + Intergenic
988197759 5:28027679-28027701 GGTGAAGCAGGCTGGGACACAGG - Intergenic
988591382 5:32552929-32552951 GGTGAAGCCAGCTGAGCTTCTGG - Intronic
988605170 5:32673171-32673193 GGTGAGGCCAGCTGGGCTTCTGG - Intergenic
988605902 5:32678326-32678348 GGTGAAGAAGGCTGGGCTTCTGG - Intergenic
988684654 5:33515304-33515326 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
989161288 5:38394010-38394032 GCCGGAGATGGCTGGGCTTCAGG - Intronic
989207164 5:38822069-38822091 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
989292484 5:39785840-39785862 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
989314289 5:40059390-40059412 GGTTAAGCAGGCTGGGCTTCTGG + Intergenic
989495849 5:42111140-42111162 TGTGAAGCCAGCTGGGCTTCTGG + Intergenic
989496713 5:42117238-42117260 CATGAAGCTGGCTGAGCTTCTGG + Intergenic
989565542 5:42897914-42897936 AGTGAAGCTGGCTGGGATGCTGG - Intergenic
989679009 5:44007384-44007406 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
989756247 5:44959025-44959047 GGTGAAGCCAGCTGGGCTCCTGG + Intergenic
989757683 5:44975320-44975342 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
989760240 5:45007158-45007180 AGTGAAGCCAGCTGGGCTTCTGG + Intergenic
989760502 5:45010199-45010221 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
989964035 5:50448501-50448523 GATGAAGCCAGCTGGGTTTCTGG - Intergenic
989964551 5:50452362-50452384 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
990116378 5:52397277-52397299 GGTGAAGCCAGCTGGGTTTCTGG + Intergenic
990117191 5:52403295-52403317 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
990418826 5:55612758-55612780 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
990419513 5:55617580-55617602 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
990485000 5:56249454-56249476 GGTAAAGCAGGCTAGGCTTCTGG - Intergenic
991120591 5:63008555-63008577 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
991330154 5:65485394-65485416 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
991717625 5:69466399-69466421 ATTGAAGCCAGCTGGGCTTCTGG + Intergenic
991767635 5:70004502-70004524 GGCGAAGCCGGCTGGGCTTCTGG + Intergenic
991846869 5:70879578-70879600 GGCGAAGCCGGCTGGGCTTCTGG + Intergenic
992276987 5:75130831-75130853 GGTGAAGCTGTCTGGGCTTCTGG - Intronic
992455779 5:76914264-76914286 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
992758683 5:79932822-79932844 GTTGAGGCTTGCTGAGCTTCTGG + Intergenic
993068956 5:83134257-83134279 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
993768418 5:91892656-91892678 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
994230828 5:97309417-97309439 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
994232105 5:97318411-97318433 GGTGAAGATGGCTGGGCTTTTGG - Intergenic
994327837 5:98469548-98469570 GCTGAAGCTGGCTGGGCTTCTGG - Intergenic
994399747 5:99264173-99264195 GGTGAATCTGGCTGGACATGGGG + Intergenic
994411324 5:99410453-99410475 CGTGAAACCGGCTGGGCTTCTGG - Intergenic
994482505 5:100354794-100354816 CGTGAAACCGGCTGGGCTTCTGG + Intergenic
994773495 5:104013622-104013644 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
994954524 5:106510838-106510860 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
995408189 5:111826086-111826108 GGTGAAGCCACCTGGGCTTCTGG + Intronic
995582898 5:113619475-113619497 GGTGAAACTGGCTGAGCTTCTGG - Intergenic
995583836 5:113626162-113626184 GGTGAAGCTGGCCAGGCTTCTGG - Intergenic
995705992 5:114989890-114989912 GGTGAAGCTGGCTAGGCTTCTGG + Intergenic
995707410 5:114999536-114999558 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
995928610 5:117407598-117407620 GATGAAGCTGGCTGGACTTCTGG - Intergenic
996099644 5:119433250-119433272 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
996211640 5:120818119-120818141 GGTGAAACCAGCTGAGCTTCTGG + Intergenic
996272006 5:121616915-121616937 GGTGAAGCAGGCTGGGCTTCTGG + Intergenic
996401102 5:123063637-123063659 GGTGAGCCTGGCTGGACTTGAGG - Intergenic
996425421 5:123308369-123308391 GGTGAAGCCAGCTGGACCTCCGG + Intergenic
996463437 5:123772772-123772794 GGTGAAGCTGGCTAGGACTCAGG + Intergenic
996534111 5:124558339-124558361 GGTGAAGCCAGCTGGACTTTTGG - Intergenic
996680003 5:126221228-126221250 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
996681217 5:126229411-126229433 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
996695379 5:126388935-126388957 AGTGGAGATGTCTGGGCTTCTGG - Intronic
996780599 5:127182610-127182632 GGTGAAGCCACCTGGGCTGCTGG + Intergenic
997072007 5:130633388-130633410 GGTGAAGCCCGCTGGGCTCCTGG + Intergenic
997073215 5:130641828-130641850 GGTGAAGCCGGCTGGGATTCTGG + Intergenic
997329352 5:133047762-133047784 GGTGAAGCCGGCTGCGCTTCTGG + Intergenic
997939430 5:138143524-138143546 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
998111052 5:139502948-139502970 GGTGAACCCGGCTGGGCTTCTGG + Intergenic
998112258 5:139511272-139511294 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
998676826 5:144418540-144418562 GGTGAAGCCAGCTAGGCTTCTGG - Intronic
998701609 5:144708956-144708978 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
998914678 5:147001000-147001022 GATGAAGCTGGCTGGGCTTCTGG + Intronic
998915553 5:147007295-147007317 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
999199384 5:149805080-149805102 CGTGATGTTGCCTGGGCTTCTGG + Intronic
999417068 5:151407616-151407638 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
999818703 5:155202595-155202617 GGTGAAGCTGGCTAGGCTTCTGG - Intergenic
999954083 5:156681283-156681305 GATGGAGATGGCTGGGCTTCTGG - Intronic
1000281715 5:159788068-159788090 TGTGATGATGGCTGGGCTTGGGG - Intergenic
1000549808 5:162647133-162647155 GGTGAAGCCAGCTGAACTTCTGG + Intergenic
1000645028 5:163750805-163750827 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1000785327 5:165535744-165535766 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1001041241 5:168337116-168337138 GGTGTAGATGGCTGGGCCGCTGG - Intronic
1001292675 5:170475219-170475241 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1001526369 5:172431392-172431414 GGAGAGCCTGGCTTGGCTTCGGG + Intronic
1001546674 5:172574705-172574727 GGTGTAGCCAACTGGGCTTCAGG - Intergenic
1001636529 5:173213877-173213899 AGTGAAGCCAGCTGGGCTCCTGG + Intergenic
1001697249 5:173680265-173680287 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1001813570 5:174648993-174649015 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1001840145 5:174868992-174869014 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1002084712 5:176766608-176766630 TGAGAACCTGGCAGGGCTTCTGG + Intergenic
1002363663 5:178693856-178693878 GGTGAATCCAGCTGGGCTTCTGG - Intergenic
1002401205 5:178992410-178992432 GATGCAGCTGGATGGGCTGCAGG - Intronic
1002560831 5:180081054-180081076 AGTGAAGTCGGCTAGGCTTCTGG - Intergenic
1002688333 5:181032668-181032690 GGTGAAGCCAGCTGGGCTTCCGG + Intergenic
1002868488 6:1145442-1145464 GGTGAACCTGGCTGCATTTCTGG + Intergenic
1003018099 6:2484494-2484516 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1003168797 6:3704161-3704183 GGTGAAGCCAGCTGGACTTCGGG - Intergenic
1003193424 6:3893866-3893888 GGTGAAGCCAACTGGGCTTCTGG - Intergenic
1003684031 6:8282851-8282873 CGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1003800022 6:9653407-9653429 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1003801080 6:9668160-9668182 GGTGAAGCTGGCTGGGCTTCTGG + Intronic
1003805388 6:9721966-9721988 GGTGAAGCCGGCTGAGCTTCTGG + Intronic
1003833381 6:10040254-10040276 GGTAAAGCCAGCTGGACTTCTGG + Intronic
1003882599 6:10491823-10491845 GGTGAAACCGGCTGGGTTTCTGG + Intergenic
1003907938 6:10719978-10720000 GGTGAAGCCCGCTGGGCTTCTGG - Intergenic
1003909896 6:10733759-10733781 GGTGAAGCCGGCTGCTCTCCAGG - Intergenic
1003910758 6:10741575-10741597 GGTGAAGCCGACTGGGCTTCTGG + Intergenic
1004586537 6:17006902-17006924 GTTGAAGCCAGCTGAGCTTCTGG - Intergenic
1004622260 6:17341478-17341500 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1004811837 6:19270977-19270999 AGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1004882578 6:20023444-20023466 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1005190069 6:23211065-23211087 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1005196678 6:23295418-23295440 GGTGAAGCCAGACGGGCTTCTGG + Intergenic
1005269010 6:24143184-24143206 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1005279566 6:24258558-24258580 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1005705282 6:28445166-28445188 GGTGAAGCTGGCTGGGCTTCCGG - Intergenic
1005935572 6:30518172-30518194 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1006217629 6:32458941-32458963 GGTGACGCTGGCTGGGCTTCTGG - Intergenic
1006221210 6:32493534-32493556 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1006221421 6:32495309-32495331 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1006222191 6:32500592-32500614 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1006226274 6:32539145-32539167 GATGAAGTCAGCTGGGCTTCCGG + Intergenic
1006230239 6:32580173-32580195 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1006302156 6:33199391-33199413 GGAGGAGCTGTCTGGGCTTCGGG + Exonic
1006669726 6:35722483-35722505 CATGAGGCTGCCTGGGCTTCCGG + Intronic
1006906614 6:37537328-37537350 GGTGAAGGAGGGTGGACTTCTGG + Intergenic
1006963920 6:37962492-37962514 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1006979828 6:38138253-38138275 GGTGGTGGTTGCTGGGCTTCTGG + Intronic
1007134281 6:39506728-39506750 GGTGACTCTTGGTGGGCTTCTGG + Intronic
1007532397 6:42554393-42554415 AGTGAAGCCGGCTAGGCTTCTGG + Intergenic
1007617953 6:43193187-43193209 GGTGCAGCAGGCTGGGCTGGCGG + Exonic
1008446567 6:51598571-51598593 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1008551753 6:52639334-52639356 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1009268000 6:61580225-61580247 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1009327354 6:62369579-62369601 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1009385058 6:63077928-63077950 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1009386299 6:63086718-63086740 GGTGAAGCTAGCTGGACTTCTGG - Intergenic
1009672961 6:66779957-66779979 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1009688220 6:66991088-66991110 GGTGAAGCCAGCTTGGCTTCTGG + Intergenic
1009690944 6:67031254-67031276 GGTGAAGCGGGCTGGGCTTCTGG + Intergenic
1009746355 6:67821726-67821748 CGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1010074561 6:71785319-71785341 GGTGAAGTTGGCTGGGCTTCCGG + Intergenic
1010075420 6:71791802-71791824 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1010248038 6:73680421-73680443 GGTTAAGCTGTCTTGGCTTAGGG - Intergenic
1011373286 6:86663671-86663693 GGTGAAGCCTGCTGGGCTTCCGG + Intergenic
1011374164 6:86672504-86672526 GATGAAGCTGGCTGGGCTTCTGG - Intergenic
1011375418 6:86681525-86681547 GATGAAGCCAGCTGGGCTTCTGG - Intergenic
1011404402 6:87002777-87002799 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1011825722 6:91303291-91303313 GGTGAAGCTAGGTGGGCTTCTGG - Intergenic
1012038421 6:94172780-94172802 GGTGAAGCCAGATGGACTTCTGG + Intergenic
1012133427 6:95524570-95524592 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1012440954 6:99261966-99261988 GGTGAAGCCGACTGGGCTTCTGG - Intergenic
1012441947 6:99269018-99269040 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1012748703 6:103128144-103128166 GATGAAGTCAGCTGGGCTTCTGG - Intergenic
1012789664 6:103677274-103677296 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1013113688 6:107084341-107084363 GGTGAAGCCAGCTGGGTTTCTGG + Intronic
1013660375 6:112289698-112289720 GCTGATGATGCCTGGGCTTCGGG + Intergenic
1013906946 6:115232292-115232314 AGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1014112526 6:117635419-117635441 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1014143035 6:117965747-117965769 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1014309972 6:119787603-119787625 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1014386367 6:120806826-120806848 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1014494138 6:122099762-122099784 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1014579036 6:123111731-123111753 GGTGAAACTGGCTGGGCTTCTGG + Intergenic
1014940173 6:127429014-127429036 GGTGAAGTTGGCTGGGCTTCTGG - Intergenic
1015665728 6:135626367-135626389 GGTGAAGCTGCCTGGGCTTCTGG - Intergenic
1016092746 6:139999499-139999521 GGTGAAGCCAGCTGGGCCCCTGG - Intergenic
1016170878 6:141014942-141014964 GGTGAAGCCGGCTGGGGTCCGGG - Intergenic
1016182835 6:141168325-141168347 GGTGAAGCCGACTGGGCTTCTGG + Intergenic
1016183540 6:141175298-141175320 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1016184702 6:141183720-141183742 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1016283899 6:142451186-142451208 GGTGAAGCCACCTGAGCTTCTGG - Intergenic
1016482232 6:144495065-144495087 GGTGAAGCCAGCTGGACTCCTGG - Intronic
1017017765 6:150115791-150115813 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
1017041477 6:150311614-150311636 GGTGACGCCAGCTGGGCTTCTGG - Intergenic
1017100905 6:150849132-150849154 GGTGAATCTGGCTAGTCTTCTGG + Intergenic
1017101869 6:150855908-150855930 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1017380369 6:153821389-153821411 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1017848714 6:158283796-158283818 GCTGAAGCTGGCTGGGGTGGAGG - Intronic
1018734846 6:166679957-166679979 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1018831092 6:167444160-167444182 GCTGCAGATGGCCGGGCTTCAGG - Intergenic
1018870430 6:167778487-167778509 GGTGAAGGTGGGTGGGCCTAGGG - Intergenic
1020211433 7:6160469-6160491 GGAGCAGCTGGCAGGGCGTCCGG + Intronic
1020375274 7:7478462-7478484 GGTGAAGCCAGCTAGGCTCCTGG - Intronic
1020571826 7:9872839-9872861 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1021006122 7:15397058-15397080 GGTGAAGCCAACTGGGCTTCTGG - Intronic
1021356026 7:19654299-19654321 GGTGAAGCCAGCTAGACTTCTGG - Intergenic
1021433195 7:20584731-20584753 AGTGAAGCTGGCTGCGCTTCTGG - Intergenic
1021572335 7:22078937-22078959 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1021710038 7:23406926-23406948 GGTGAAGGTGGCTGGGCTTCTGG - Intronic
1021778623 7:24079336-24079358 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1021919003 7:25464933-25464955 AGTGAAGCAGGCTGGGCACCAGG + Intergenic
1021943276 7:25700810-25700832 GATGAAGCCAGCTGGGCTTCCGG - Intergenic
1022450324 7:30507831-30507853 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1022458553 7:30581400-30581422 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1022541290 7:31137552-31137574 GGTGAACCTGGCTGGGCTTTTGG - Intergenic
1022577960 7:31517370-31517392 GGTGAAGCCGGCTGGGTTTCTGG - Intronic
1022642939 7:32205338-32205360 GGTGAATCTGGCTGGGCTTCTGG + Intronic
1022679633 7:32532151-32532173 GTTGGAGATGGCTGGACTTCAGG - Intronic
1022803425 7:33797918-33797940 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1023027740 7:36066089-36066111 GGTGAAGTCGCCTGGGTTTCTGG - Intergenic
1023077625 7:36499667-36499689 GGTGAAGCCAGCAGGGCTTCTGG - Intergenic
1023105986 7:36763719-36763741 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1023151478 7:37205065-37205087 GGTGAAGCCGGCTGGGCTTCTGG - Intronic
1023167112 7:37353874-37353896 GGTGGAGCCGACTGGGCTTCTGG - Intronic
1023181825 7:37492374-37492396 GGTGAAGCCAGCTGTGCTTCTGG + Intergenic
1023338447 7:39194385-39194407 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1023401782 7:39796512-39796534 GGAGAAACTGACTGGGCTTTGGG - Intergenic
1023444616 7:40218464-40218486 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1023505656 7:40897708-40897730 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1023511946 7:40962390-40962412 GGTGAAGCCAGCTGGGTTTCTGG - Intergenic
1023546099 7:41318994-41319016 GGTGAAGACAGCTGGGCTTCTGG - Intergenic
1023557079 7:41435029-41435051 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1023771286 7:43558846-43558868 GGTGGAGCGGTATGGGCTTCTGG + Intronic
1024075763 7:45817157-45817179 GGAGAAACTGACTGGGCTTTGGG - Intergenic
1024091064 7:45940130-45940152 GGTGAAGCCGGCTGGGATTCTGG + Intergenic
1024223137 7:47303635-47303657 GGTGACGCTTGCTGGTCTTCAGG - Intronic
1024443206 7:49445882-49445904 GATGAAGCCAGCTGGGCTTCTGG + Intergenic
1024647835 7:51384150-51384172 GGAGAAACTGACTGGGCTTTGGG + Intergenic
1024795738 7:53017427-53017449 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1024811379 7:53216859-53216881 GGTGAAGCTGGCTGGGCTTGGGG + Intergenic
1024820435 7:53322943-53322965 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1024867554 7:53921044-53921066 GGTGAAGCCAGTTGGGCTTCTGG + Intergenic
1024870112 7:53955338-53955360 GGTGAAGCCAACTGGGCTTCTGG - Intergenic
1024871180 7:53962960-53962982 CGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1025051676 7:55738637-55738659 GGAGAAACTGACTGGGCTTTGGG + Intergenic
1025128638 7:56364304-56364326 GGAGAAACTGACTGGGCTTTGGG + Intergenic
1026199427 7:68201431-68201453 CGTGAAGGTGGCTGGGCTTCTGG - Intergenic
1026673795 7:72412594-72412616 GGTGAAGCCAGCTGGGCTTCTGG - Intronic
1027552454 7:79616295-79616317 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1027590548 7:80113671-80113693 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1027655645 7:80927335-80927357 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1027664976 7:81034017-81034039 GGTGAAGCCAGGTGGGCTTCTGG + Intergenic
1028495657 7:91456882-91456904 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1028639132 7:93023516-93023538 CGTGAAGCCAGCTAGGCTTCTGG - Intergenic
1029081740 7:97980031-97980053 CGTGCAGCTGGGTGGGGTTCAGG - Intergenic
1030420115 7:109298994-109299016 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1030420825 7:109304311-109304333 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1030950898 7:115789900-115789922 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1031529442 7:122858244-122858266 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1031632774 7:124064471-124064493 GGTGAAGCAGGCTGGGCTTCTGG + Intergenic
1031730888 7:125299421-125299443 GGTGAAGCCAGCTCGGCTTCTGG - Intergenic
1031732362 7:125314846-125314868 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1031846004 7:126806664-126806686 GGTGAAGCCGGCTGGGTTTCTGG - Intronic
1032268399 7:130383818-130383840 GGGGAAGCAGGATGGGCCTCTGG + Intronic
1032611893 7:133423945-133423967 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1032722571 7:134562682-134562704 GGTGTAGCCAGCTGGACTTCTGG - Intronic
1033877755 7:145843070-145843092 GGTGACGCTGGCTGGAACTCAGG + Intergenic
1034579289 7:152028649-152028671 GGTGAAGCTGGCTGTGCTTCTGG - Intronic
1034628971 7:152515890-152515912 GGTGAAGCCGGCTGGGCCTGTGG - Intergenic
1034870355 7:154677882-154677904 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1035356546 7:158279385-158279407 GGTGAAGCTGGCTGGGCTGCTGG - Intronic
1035436406 7:158863399-158863421 GGTGAAGCCTCCTGGGCTTCTGG - Intronic
1035559183 8:592469-592491 GGAGAAGCTGACTGGGCTTCAGG - Intergenic
1036119565 8:6001243-6001265 GCTAAAGCTGGCTGAGGTTCAGG - Intergenic
1036161179 8:6389884-6389906 GGTGAAGCCTGCTGGGCTTCTGG + Intergenic
1036837672 8:12088963-12088985 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1036859465 8:12335211-12335233 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1036952441 8:13154156-13154178 GGGGAAGCCAGCTGGGCTTCTGG - Intronic
1037638507 8:20721898-20721920 AGTCAAGCTGCCTGGGCTCCTGG - Intergenic
1038726745 8:30088458-30088480 GGTGAAGCCGGCTAGGCTTCTGG + Intergenic
1039692287 8:39876601-39876623 GGTGAAGTCGGCTGGGCTTCTGG - Intergenic
1039693554 8:39885714-39885736 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1039810761 8:41046127-41046149 AGTGAAGCCAGCTGGACTTCTGG - Intergenic
1039998908 8:42560210-42560232 GGTGAAGCCAGCTGGGCTTATGG - Intergenic
1040000099 8:42568423-42568445 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1040539821 8:48342521-48342543 GGTGAACCTGGTGGGGCTCCTGG - Intergenic
1040558993 8:48507056-48507078 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1040638810 8:49306621-49306643 GGTGAAGCCGACTGGGCTTCTGG + Intergenic
1040649833 8:49435013-49435035 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1040667297 8:49650153-49650175 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1040668245 8:49656977-49656999 GGTGAAGATGGCTGGGCTTCTGG - Intergenic
1040732919 8:50471138-50471160 GGTTAAGCCGGCTGGGCTTCTGG - Intronic
1040970892 8:53136881-53136903 GATGAAGCCAGCTGGACTTCTGG - Intergenic
1040971843 8:53143613-53143635 GGTGAAGCCACCTGGACTTCTGG - Intergenic
1040999554 8:53437414-53437436 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1041000325 8:53443194-53443216 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1041001504 8:53459348-53459370 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1041002827 8:53468452-53468474 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1041068270 8:54102515-54102537 GGTAAAGCCAGCTGGTCTTCTGG + Intergenic
1041162268 8:55057863-55057885 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1041176912 8:55206418-55206440 GGTGAAGCCAGGTGGGCTCCTGG - Intronic
1041435868 8:57841149-57841171 GGTGAAGCCAGCTGAGCTTCTGG + Intergenic
1041840137 8:62259878-62259900 GGTGAAGGTGGGTGGGCGGCAGG + Intronic
1042037548 8:64552092-64552114 CATGAAGCTGGCTTGGCTCCTGG - Intergenic
1042155513 8:65841300-65841322 GGTGAAGCTGGGTGGGCAGAGGG + Intronic
1043002066 8:74771754-74771776 GGTGAAGCTGTCTGGGCTTCTGG - Intronic
1043034405 8:75178559-75178581 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1043224103 8:77701029-77701051 GGTAAAGCTGGCTGGGCTTCTGG + Intergenic
1043270718 8:78329754-78329776 GGTGATCCAGGCTGGGCTCCAGG - Intergenic
1043393873 8:79817834-79817856 GGTGCAGCTGCCTGGGCTAATGG + Intergenic
1043597827 8:81904526-81904548 GGTGAAGCTGGCTGGGTTTCTGG + Intergenic
1043690060 8:83140245-83140267 GGTGAAGCTGGTTGGGCTTCTGG - Intergenic
1043709446 8:83396712-83396734 GGTAAAGCTGGCTGGGCTTCTGG + Intergenic
1043740938 8:83810749-83810771 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1043916409 8:85927694-85927716 GGTGAAGCCAGCTGAACTTCTGG + Intergenic
1044008838 8:86967087-86967109 GGTGAAGCCGGGTGGGCTTCTGG - Intronic
1044013644 8:87025050-87025072 GGTGAAGCCAGCTGGGCGTCTGG + Intronic
1044302870 8:90606256-90606278 GGTGAAGCCGGCCGGGCTTCTGG - Intergenic
1044413821 8:91913722-91913744 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1044455995 8:92393726-92393748 GGTGTAGCCGGCTGGGCTTCTGG - Intergenic
1044457056 8:92401253-92401275 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1044748900 8:95397701-95397723 AGTGAAGCCGGCTATGCTTCTGG - Intergenic
1045297187 8:100882357-100882379 GGTGAAGGTGGCTGGGAGGCTGG + Intergenic
1045792215 8:105996648-105996670 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1046055189 8:109070958-109070980 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1046329693 8:112698789-112698811 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1046397518 8:113659299-113659321 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1046490837 8:114951567-114951589 GGTGAAGCCAACTGGGCTTCTGG - Intergenic
1046507866 8:115159367-115159389 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1046574981 8:116016800-116016822 GGTGAGGGTGGCTGGGCATGGGG + Intergenic
1047526093 8:125635360-125635382 GCTGCAGGTGGCTGGGCTGCAGG + Intergenic
1047782244 8:128119481-128119503 GGTGAAGCTGGCTAGGCTTCAGG + Intergenic
1047807436 8:128375040-128375062 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1047808501 8:128382425-128382447 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1048161927 8:132029235-132029257 GGAGAAGCAGGCTGTGCTTGAGG - Intronic
1048703017 8:137115784-137115806 GGTGAAGCTGGGTGGCCTTCTGG - Intergenic
1048756176 8:137740705-137740727 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1049230487 8:141479021-141479043 GCTGGAGCTGGCTGGGGTCCAGG + Intergenic
1049422430 8:142522887-142522909 GGAGAAGCTGGCTGGCCAACAGG - Intronic
1049790082 8:144468440-144468462 GGTGAGGCGGGCTGGGGTTTTGG + Intronic
1049827161 8:144676610-144676632 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1049944063 9:577544-577566 GGTGAAGCCGGCTGAGCTTCTGG - Intronic
1050456829 9:5842365-5842387 GGTGAAGCCGGTTGGGCTTCTGG - Intergenic
1050898295 9:10911229-10911251 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1051272090 9:15365524-15365546 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1051447331 9:17154599-17154621 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1051555320 9:18376069-18376091 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1051617668 9:19021679-19021701 GGTGAAGCCAGCTGAGCTTCTGG + Intronic
1051622922 9:19070121-19070143 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1051934829 9:22434054-22434076 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1051935864 9:22441233-22441255 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1052058217 9:23926405-23926427 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1052160153 9:25247478-25247500 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1052203307 9:25808453-25808475 GGTGAAGCCGGTTGGGCTTCTGG - Intergenic
1052372045 9:27676069-27676091 GGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1052794138 9:32907293-32907315 GGTGAAGCTGACTGGACTTCTGG - Intergenic
1052896110 9:33749938-33749960 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1053192725 9:36086746-36086768 GGTGAAGCCGGCTGGGCCTCTGG - Intronic
1053236337 9:36458148-36458170 GGTGAAGCCAGCTGGACTTCTGG + Intronic
1053598851 9:39590272-39590294 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1053856604 9:42344789-42344811 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1055236958 9:74133796-74133818 GCTGGAGATGGCTGGACTTCAGG - Intergenic
1055456579 9:76477884-76477906 GGTGAAGCCAGCTGGGCTTCTGG + Intronic
1055462051 9:76528691-76528713 GGTGAAGCCAGCTGGGCTTTTGG - Intergenic
1055636556 9:78284548-78284570 GGTGAAGCTGGCTAGGCTTCTGG - Intergenic
1055653470 9:78430999-78431021 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1056391874 9:86148419-86148441 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1056673546 9:88652724-88652746 GTAGAAGCTGGCTTGTCTTCTGG - Intergenic
1056858813 9:90160869-90160891 GGTGAAGCCACCTGGACTTCTGG + Intergenic
1057049938 9:91915914-91915936 GGTGAAGCCAGCTGGATTTCTGG - Intronic
1057298539 9:93863191-93863213 GGTGAAGCCAGCTGGATTTCTGG - Intergenic
1057344344 9:94235135-94235157 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1057438857 9:95067164-95067186 GGTGGATCTGTCTGGACTTCAGG + Intronic
1057724305 9:97557352-97557374 GGTGATGCTGGCTGGCTTTAGGG + Intronic
1058106724 9:100980319-100980341 GGTGAAGCAAGCGGGGCTTCTGG - Intergenic
1058265031 9:102888745-102888767 GGAGAAGCCAGCTGGGCTTCTGG + Intergenic
1058364677 9:104195013-104195035 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1058403251 9:104641422-104641444 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1058736633 9:107899914-107899936 GGAGAAGATGGCTGGGCATGGGG - Intergenic
1059453527 9:114385865-114385887 AGAGAAGCAGGCTGGGCATCAGG + Intronic
1061299624 9:129697282-129697304 GAGGGAGCTGGCTGGGCTGCAGG + Intronic
1061991142 9:134159372-134159394 GGCAGAGCTGGCTGGGCTCCGGG - Exonic
1062036078 9:134383171-134383193 GGTGAAGCGGCCTGGGCTCTCGG - Intronic
1062377482 9:136268903-136268925 GGGGAAGCTGGCTGAGCTGGAGG + Intergenic
1185817579 X:3170511-3170533 TGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1187548927 X:20281851-20281873 GGTGACTCTTGCTGGGCTTCTGG + Intergenic
1188078215 X:25805697-25805719 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1188097326 X:26041380-26041402 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1188098140 X:26047219-26047241 GGTGAAGCCAGCTAGACTTCTGG + Intergenic
1188176973 X:27002830-27002852 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1188248072 X:27857708-27857730 GGTGAAGCCGGCTGGGTTTCTGG - Intergenic
1188766292 X:34096030-34096052 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1189187878 X:39069980-39070002 GGTGAAGTTGGCTGGACTTCTGG - Intergenic
1189681090 X:43517288-43517310 GATGAAGCTGGCTGCCCTTGTGG - Intergenic
1189757120 X:44283062-44283084 GGTGCCCCTGGGTGGGCTTCTGG - Intronic
1189952206 X:46244455-46244477 TGTGAAGCTGGCTGAGCTTCTGG - Intergenic
1190136095 X:47799424-47799446 GCTGCAGCTTGCAGGGCTTCAGG + Intergenic
1191927526 X:66329421-66329443 CGTGAAGCCGGCTGGGCTTCTGG + Intergenic
1192027487 X:67469563-67469585 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1192486264 X:71529493-71529515 GGTGAAGCCAGCTGGACTTCTGG - Intronic
1193145764 X:78074051-78074073 GGTGAAACCAGCTGAGCTTCTGG - Intronic
1193264878 X:79456217-79456239 GGTGAAGCCCACTGGGCTTCTGG + Intergenic
1193600496 X:83504273-83504295 GCTGAAGCTGGCAGGGGGTCAGG - Intergenic
1193962154 X:87939670-87939692 GGTGAATCCAGCTGGGCTTCTGG - Intergenic
1194021001 X:88692385-88692407 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1194066653 X:89269716-89269738 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1194077722 X:89417280-89417302 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1194376997 X:93149107-93149129 GGTGAAGCTGGCTGGGCGTCTGG + Intergenic
1194408916 X:93532868-93532890 GGTGAAGCCAGCTGGACTTCTGG + Intergenic
1194478511 X:94390478-94390500 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1195439143 X:104882464-104882486 GGTGAAGCCGGCTGGGCTTCTGG + Intronic
1195706606 X:107742141-107742163 GGTGATGTGGGCTGGGCTTCCGG + Intronic
1196126774 X:112109724-112109746 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1196127741 X:112116750-112116772 GGTGAAGCCAGTTGGACTTCTGG - Intergenic
1196319454 X:114270477-114270499 GGTGAAGCCAGCTGGGCTCCTGG - Intergenic
1196488593 X:116243388-116243410 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1196663644 X:118294399-118294421 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1196853042 X:119956895-119956917 GGTGAAGCCAGCTGGACTTCTGG - Intergenic
1197078932 X:122388904-122388926 GGTGAAGCTGGCTGGGCTTCTGG - Intergenic
1197512982 X:127394642-127394664 GATAAAGCCAGCTGGGCTTCTGG + Intergenic
1198274096 X:135085371-135085393 GGTGAAGCTTGCTGGAACTCAGG + Intergenic
1199082151 X:143588975-143588997 GGTAAAGCCAGCTGGGCTCCTGG - Intergenic
1199437422 X:147828522-147828544 GGTGAGGCTGGCTGAGCTTCTGG - Intergenic
1199443649 X:147897028-147897050 GGTAAAGCCTGCTGGGCTTCTGG - Intergenic
1199556381 X:149113923-149113945 GGTGAAGCCGGCTGGGCTTCTGG - Intergenic
1200383567 X:155865580-155865602 GGTGAAGTCAGCTGGGCTTCTGG + Intergenic
1200430374 Y:3072825-3072847 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1200720828 Y:6603894-6603916 GGTGAAGCCAGCTGGCCTTCTGG - Intergenic
1200748376 Y:6922732-6922754 GGTGAACCTGACTGGGCTTCTGG - Intronic
1200750372 Y:6939419-6939441 GGTGACGCCAGCTGGGCTTCTGG - Intronic
1200880277 Y:8205509-8205531 GGTGAAGTCAGCTGAGCTTCTGG - Intergenic
1200881174 Y:8212617-8212639 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1200958970 Y:8979976-8979998 GGTGAAGCTGGCTGGGCTTCCGG + Intergenic
1200960087 Y:8988414-8988436 GGTGAAGCTAGCTGGGCTTCTGG + Intergenic
1200962979 Y:9011938-9011960 AGTGAAGCTAGCTGGGCTTCTGG - Intergenic
1201279174 Y:12326237-12326259 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic
1201403375 Y:13627369-13627391 GCTGAAGCCAGCTGGGCTTCTGG + Intergenic
1201404593 Y:13636780-13636802 GGTGAAGCTGGCTGGGCTTCTGG + Intergenic
1201568089 Y:15387067-15387089 GGTGAAGCTGGCTGTGCTTCTGG - Intergenic
1201568949 Y:15393992-15394014 GTTGAAGCCAGTTGGGCTTCTGG - Intergenic
1201595770 Y:15667190-15667212 GGTGAAGCCTGGTGGGCTTCTGG + Intergenic
1201630883 Y:16071035-16071057 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1201632076 Y:16080092-16080114 GGTGAAGCTGCTTGGGTTTCTGG + Intergenic
1201743570 Y:17348060-17348082 GGTGAAGCCGGTTGGGCTTCTGG - Intergenic
1201744349 Y:17354185-17354207 GGTGAAGCCAGCTAGTCTTCTGG - Intergenic
1201907508 Y:19100800-19100822 GGTGAAGTCAGCTGGACTTCTGG - Intergenic
1201985723 Y:19962634-19962656 AGTGAAGCCAGCTGGGTTTCTGG - Intergenic
1202074300 Y:21023006-21023028 TGTGAATCTGGCTGGGCTTCTGG - Intergenic
1202075053 Y:21029024-21029046 TGTGAAGGCAGCTGGGCTTCTGG - Intergenic
1202090515 Y:21183599-21183621 GGTGAAACCGGCTGGATTTCTGG + Intergenic
1202148225 Y:21822051-21822073 GGGTAAGCTGGCTGTGCTCCAGG + Intergenic
1202150125 Y:21836843-21836865 AGAGAAGCTGGCTGGGCTTCTGG + Intergenic
1202193000 Y:22263089-22263111 GGTGAAGCCAGCTGAGCTTCTGG - Intergenic
1202242479 Y:22785792-22785814 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1202257449 Y:22936813-22936835 GGTAAAACTGGCTGGGCTTTGGG + Intergenic
1202395464 Y:24419541-24419563 GGTGAAGCCAGCTGGGCTTCTGG + Intergenic
1202410439 Y:24570560-24570582 GGTAAAACTGGCTGGGCTTTGGG + Intergenic
1202460342 Y:25099512-25099534 GGTAAAACTGGCTGGGCTTTGGG - Intergenic
1202475320 Y:25250551-25250573 GGTGAAGCCAGCTGGGCTTCTGG - Intergenic