ID: 1051272093

View in Genome Browser
Species Human (GRCh38)
Location 9:15365536-15365558
Sequence GCTGGTGTCTGAGGTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272093_1051272104 17 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272093_1051272102 12 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272093_1051272106 19 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272093_1051272103 16 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272093_1051272105 18 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272093_1051272099 -2 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272093_1051272100 1 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272100 9:15365560-15365582 CTTTGGGAGGCCGATGCAGGTGG 0: 143
1: 28815
2: 120336
3: 164052
4: 163387
1051272093_1051272107 20 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272093 Original CRISPR GCTGGTGTCTGAGGTGAAGC TGG (reversed) Intergenic
No off target data available for this crispr