ID: 1051272095

View in Genome Browser
Species Human (GRCh38)
Location 9:15365544-15365566
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272090_1051272095 -3 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272089_1051272095 -2 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272085_1051272095 8 Left 1051272085 9:15365513-15365535 CCCCACCGGACCCAGAAGCCCAG No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272088_1051272095 3 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272091_1051272095 -10 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272087_1051272095 6 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272086_1051272095 7 Left 1051272086 9:15365514-15365536 CCCACCGGACCCAGAAGCCCAGC No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data
1051272084_1051272095 14 Left 1051272084 9:15365507-15365529 CCAAGTCCCCACCGGACCCAGAA No data
Right 1051272095 9:15365544-15365566 ACCTCAGACACCAGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272095 Original CRISPR ACCTCAGACACCAGCACTTT GGG Intergenic
No off target data available for this crispr