ID: 1051272098

View in Genome Browser
Species Human (GRCh38)
Location 9:15365554-15365576
Sequence GCATCGGCCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679951
Summary {0: 347, 1: 85653, 2: 217333, 3: 227469, 4: 149149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272098_1051272105 0 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272098_1051272109 27 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272109 9:15365604-15365626 CAAGACCAGCCTGACCAACATGG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050
1051272098_1051272104 -1 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272098_1051272106 1 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272098_1051272107 2 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055
1051272098_1051272103 -2 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272098_1051272102 -6 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272098 Original CRISPR GCATCGGCCTCCCAAAGTGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr