ID: 1051272099

View in Genome Browser
Species Human (GRCh38)
Location 9:15365557-15365579
Sequence GCACTTTGGGAGGCCGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 710564
Summary {0: 366, 1: 88627, 2: 228377, 3: 238400, 4: 154794}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272091_1051272099 3 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272084_1051272099 27 Left 1051272084 9:15365507-15365529 CCAAGTCCCCACCGGACCCAGAA No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272088_1051272099 16 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272093_1051272099 -2 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272089_1051272099 11 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272092_1051272099 2 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272086_1051272099 20 Left 1051272086 9:15365514-15365536 CCCACCGGACCCAGAAGCCCAGC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272090_1051272099 10 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272085_1051272099 21 Left 1051272085 9:15365513-15365535 CCCCACCGGACCCAGAAGCCCAG No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
1051272087_1051272099 19 Left 1051272087 9:15365515-15365537 CCACCGGACCCAGAAGCCCAGCC No data
Right 1051272099 9:15365557-15365579 GCACTTTGGGAGGCCGATGCAGG 0: 366
1: 88627
2: 228377
3: 238400
4: 154794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272099 Original CRISPR GCACTTTGGGAGGCCGATGC AGG Intergenic
Too many off-targets to display for this crispr