ID: 1051272102

View in Genome Browser
Species Human (GRCh38)
Location 9:15365571-15365593
Sequence CGATGCAGGTGGATCACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182119
Summary {0: 33, 1: 6542, 2: 28555, 3: 60311, 4: 86678}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272093_1051272102 12 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272098_1051272102 -6 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272088_1051272102 30 Left 1051272088 9:15365518-15365540 CCGGACCCAGAAGCCCAGCCAGC 0: 60
1: 116
2: 243
3: 336
4: 1573
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272089_1051272102 25 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272096_1051272102 3 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272091_1051272102 17 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272090_1051272102 24 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678
1051272092_1051272102 16 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272102 9:15365571-15365593 CGATGCAGGTGGATCACCTGAGG 0: 33
1: 6542
2: 28555
3: 60311
4: 86678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272102 Original CRISPR CGATGCAGGTGGATCACCTG AGG Intergenic
Too many off-targets to display for this crispr