ID: 1051272103

View in Genome Browser
Species Human (GRCh38)
Location 9:15365575-15365597
Sequence GCAGGTGGATCACCTGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38835
Summary {0: 1812, 1: 5413, 2: 9643, 3: 10748, 4: 11219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272092_1051272103 20 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272089_1051272103 29 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272093_1051272103 16 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272090_1051272103 28 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272096_1051272103 7 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272098_1051272103 -2 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
1051272091_1051272103 21 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272103 9:15365575-15365597 GCAGGTGGATCACCTGAGGTCGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272103 Original CRISPR GCAGGTGGATCACCTGAGGT CGG Intergenic
Too many off-targets to display for this crispr