ID: 1051272104

View in Genome Browser
Species Human (GRCh38)
Location 9:15365576-15365598
Sequence CAGGTGGATCACCTGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332880
Summary {0: 15509, 1: 42872, 2: 77507, 3: 95405, 4: 101587}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272089_1051272104 30 Left 1051272089 9:15365523-15365545 CCCAGAAGCCCAGCCAGCTTCAC 0: 105
1: 172
2: 334
3: 296
4: 723
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272098_1051272104 -1 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272091_1051272104 22 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272092_1051272104 21 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272090_1051272104 29 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272096_1051272104 8 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
1051272093_1051272104 17 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272104 9:15365576-15365598 CAGGTGGATCACCTGAGGTCGGG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272104 Original CRISPR CAGGTGGATCACCTGAGGTC GGG Intergenic
Too many off-targets to display for this crispr