ID: 1051272105

View in Genome Browser
Species Human (GRCh38)
Location 9:15365577-15365599
Sequence AGGTGGATCACCTGAGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7772
Summary {0: 41, 1: 438, 2: 1613, 3: 2302, 4: 3378}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272096_1051272105 9 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272091_1051272105 23 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272093_1051272105 18 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272098_1051272105 0 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272092_1051272105 22 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378
1051272090_1051272105 30 Left 1051272090 9:15365524-15365546 CCAGAAGCCCAGCCAGCTTCACC 0: 97
1: 164
2: 333
3: 288
4: 415
Right 1051272105 9:15365577-15365599 AGGTGGATCACCTGAGGTCGGGG 0: 41
1: 438
2: 1613
3: 2302
4: 3378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272105 Original CRISPR AGGTGGATCACCTGAGGTCG GGG Intergenic
Too many off-targets to display for this crispr