ID: 1051272106

View in Genome Browser
Species Human (GRCh38)
Location 9:15365578-15365600
Sequence GGTGGATCACCTGAGGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8444
Summary {0: 57, 1: 1134, 2: 1926, 3: 2411, 4: 2916}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272098_1051272106 1 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272093_1051272106 19 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272096_1051272106 10 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272092_1051272106 23 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916
1051272091_1051272106 24 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272106 9:15365578-15365600 GGTGGATCACCTGAGGTCGGGGG 0: 57
1: 1134
2: 1926
3: 2411
4: 2916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272106 Original CRISPR GGTGGATCACCTGAGGTCGG GGG Intergenic
Too many off-targets to display for this crispr