ID: 1051272107

View in Genome Browser
Species Human (GRCh38)
Location 9:15365579-15365601
Sequence GTGGATCACCTGAGGTCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7255
Summary {0: 37, 1: 375, 2: 637, 3: 1151, 4: 5055}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272093_1051272107 20 Left 1051272093 9:15365536-15365558 CCAGCTTCACCTCAGACACCAGC No data
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055
1051272092_1051272107 24 Left 1051272092 9:15365532-15365554 CCAGCCAGCTTCACCTCAGACAC No data
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055
1051272096_1051272107 11 Left 1051272096 9:15365545-15365567 CCTCAGACACCAGCACTTTGGGA No data
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055
1051272098_1051272107 2 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055
1051272091_1051272107 25 Left 1051272091 9:15365531-15365553 CCCAGCCAGCTTCACCTCAGACA No data
Right 1051272107 9:15365579-15365601 GTGGATCACCTGAGGTCGGGGGG 0: 37
1: 375
2: 637
3: 1151
4: 5055

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272107 Original CRISPR GTGGATCACCTGAGGTCGGG GGG Intergenic
Too many off-targets to display for this crispr