ID: 1051272109

View in Genome Browser
Species Human (GRCh38)
Location 9:15365604-15365626
Sequence CAAGACCAGCCTGACCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524920
Summary {0: 10734, 1: 66234, 2: 131886, 3: 161016, 4: 155050}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051272108_1051272109 -6 Left 1051272108 9:15365587-15365609 CCTGAGGTCGGGGGGTTCAAGAC No data
Right 1051272109 9:15365604-15365626 CAAGACCAGCCTGACCAACATGG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050
1051272098_1051272109 27 Left 1051272098 9:15365554-15365576 CCAGCACTTTGGGAGGCCGATGC 0: 347
1: 85653
2: 217333
3: 227469
4: 149149
Right 1051272109 9:15365604-15365626 CAAGACCAGCCTGACCAACATGG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050
1051272101_1051272109 11 Left 1051272101 9:15365570-15365592 CCGATGCAGGTGGATCACCTGAG 0: 71
1: 12428
2: 34539
3: 63139
4: 77428
Right 1051272109 9:15365604-15365626 CAAGACCAGCCTGACCAACATGG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051272109 Original CRISPR CAAGACCAGCCTGACCAACA TGG Intergenic
Too many off-targets to display for this crispr