ID: 1051274211

View in Genome Browser
Species Human (GRCh38)
Location 9:15383471-15383493
Sequence ACTTGAGGAAATAAGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051274208_1051274211 12 Left 1051274208 9:15383436-15383458 CCTCAAGTTAAGGGCTATGAGAG No data
Right 1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051274211 Original CRISPR ACTTGAGGAAATAAGCAAGG AGG Intergenic
No off target data available for this crispr