ID: 1051278378

View in Genome Browser
Species Human (GRCh38)
Location 9:15418215-15418237
Sequence CTTGGGAAACAGCAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051278372_1051278378 1 Left 1051278372 9:15418191-15418213 CCTCCACTCATCTGAGCCGTATC No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data
1051278368_1051278378 30 Left 1051278368 9:15418162-15418184 CCGGCACGAGGACCAAGAACCCT No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data
1051278371_1051278378 10 Left 1051278371 9:15418182-15418204 CCTCGTGTTCCTCCACTCATCTG No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data
1051278370_1051278378 11 Left 1051278370 9:15418181-15418203 CCCTCGTGTTCCTCCACTCATCT No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data
1051278369_1051278378 18 Left 1051278369 9:15418174-15418196 CCAAGAACCCTCGTGTTCCTCCA No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data
1051278373_1051278378 -2 Left 1051278373 9:15418194-15418216 CCACTCATCTGAGCCGTATCACT No data
Right 1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051278378 Original CRISPR CTTGGGAAACAGCAGGTGCA AGG Intergenic
No off target data available for this crispr