ID: 1051281313

View in Genome Browser
Species Human (GRCh38)
Location 9:15444049-15444071
Sequence GGCTGAACTGGTTTAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051281313 Original CRISPR GGCTGAACTGGTTTAGATGC AGG (reversed) Intronic
900324591 1:2102191-2102213 GGCTGAACTGGTGTGGAGGTCGG - Intronic
903930364 1:26858473-26858495 GACTGGACTGGTTTAGATGTGGG + Intergenic
908045743 1:60166673-60166695 GACAGACCTGGTATAGATGCAGG - Intergenic
914260593 1:145996092-145996114 GGCTAAAGTGCTTTGGATGCAGG - Exonic
916004898 1:160651078-160651100 GTCAGAAATGGTTTAGATGAAGG + Intergenic
917264957 1:173210953-173210975 GGCTGTACTCATTTAAATGCAGG + Intergenic
919254647 1:195105445-195105467 AGCTGGAGTGGTTGAGATGCAGG + Intergenic
922941294 1:229469365-229469387 GACAGAAATGGTTAAGATGCTGG - Intronic
1063808960 10:9681545-9681567 GGCTGAAGTGGCTGGGATGCAGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1068254604 10:54493637-54493659 GGCTGAACTAGTTTACAGTCGGG - Intronic
1068564317 10:58555107-58555129 AGCTGAAATGGTTTAGATCTAGG + Intronic
1069293026 10:66807216-66807238 GGCTGAACTTTTTTTGAAGCAGG - Intronic
1069759302 10:70797808-70797830 GGCTGGACTGGTTGAGACACTGG + Intergenic
1071299965 10:84248987-84249009 GGCTGCACTGCTGCAGATGCTGG - Exonic
1074890076 10:117728408-117728430 GGCTGCACTTGTTTAGGTGGTGG + Intergenic
1076980205 11:200061-200083 GGCGGATCTTGTGTAGATGCCGG - Exonic
1083727287 11:64635210-64635232 GGCTGAACTGATTTGGGAGCAGG + Intronic
1084063698 11:66691478-66691500 GGCTGACCTGCTTGAGCTGCTGG - Exonic
1084391475 11:68880084-68880106 TGCTGAACAGGTGGAGATGCTGG - Intergenic
1086195495 11:84134066-84134088 GCCTGTACTCGGTTAGATGCTGG + Intronic
1087268140 11:96083403-96083425 GGCTGGACTGGCCTATATGCTGG - Intronic
1088175801 11:107051581-107051603 GGCTGGAGTGGCTTGGATGCAGG - Intergenic
1091139506 11:133223056-133223078 GGCTGAACTGGTTGGGGTGAGGG - Intronic
1091320427 11:134645666-134645688 GGCTCAGTGGGTTTAGATGCTGG + Intergenic
1093567146 12:20620938-20620960 AGATTAACTGGTTAAGATGCGGG - Intronic
1093967290 12:25340859-25340881 GGCTGAAGTGGCTAGGATGCAGG + Intergenic
1094785799 12:33846911-33846933 GGCTGGAGTGGCTGAGATGCAGG + Intergenic
1100715392 12:97300526-97300548 GGCTGAACTTTTGTATATGCAGG + Intergenic
1107074596 13:36309318-36309340 GGCTGAACTAGTTTACATTCTGG - Intronic
1107469862 13:40681858-40681880 AGATGAGATGGTTTAGATGCTGG - Intergenic
1109065149 13:57677889-57677911 GGCTGAAGTGGTTGAGAGGCCGG + Intronic
1109859696 13:68180473-68180495 GGCTGAAGTAGTTGGGATGCAGG + Intergenic
1110717942 13:78729326-78729348 GGCTGAAATGGGTTAGTTGATGG + Intergenic
1113452984 13:110425322-110425344 GGCTGAACGACTTTATATGCAGG - Intronic
1114534000 14:23411841-23411863 GGCTGAACTTGTTTAGTTGGAGG + Intergenic
1114921950 14:27343272-27343294 GGCTGGAGTGGTTGGGATGCAGG - Intergenic
1118507117 14:66425631-66425653 GACTAAACTGGGTTAGTTGCTGG - Intergenic
1119964009 14:78892985-78893007 TGCTGAACTAGTTGAGACGCTGG - Intronic
1124226233 15:27897408-27897430 GGCTGGACTGGTTGGAATGCAGG - Intronic
1128698416 15:69786455-69786477 GTCTGACCTGGTTTGGGTGCAGG - Intergenic
1129620156 15:77136978-77137000 GGCTGGAGTGGTTAAGATACAGG - Intronic
1140128774 16:72139229-72139251 GGCTGAGCTGGGTTTGATTCTGG - Intronic
1140626192 16:76797393-76797415 GGCTGAAGAGATTTGGATGCTGG - Intergenic
1140650798 16:77085836-77085858 GACTGAATTGGTTTGGATGGGGG + Intergenic
1145694846 17:26779668-26779690 GGCTGCCTTGGTTTAGATCCTGG - Intergenic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1148954998 17:51346219-51346241 GGCTGACCTGGGTGAGATCCTGG + Intergenic
1157164380 18:45344814-45344836 GGCTGGACTGGTTTACGTGACGG - Intronic
1157473111 18:48004783-48004805 TGCTGAGCTGGTTTTGAAGCAGG - Intergenic
1166959035 19:46487067-46487089 GGCTGGACTGGTCCAGATGAAGG - Intronic
1168513184 19:56989748-56989770 GGCAGGACTGCTTTAGATGCAGG + Intergenic
925527037 2:4814246-4814268 GGCTGAAATGGCTGGGATGCAGG + Intergenic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
927400777 2:22707479-22707501 GGCTGAAGTGGCTTGGATGCAGG + Intergenic
931299996 2:60970218-60970240 GTCTCAAATGGTTTAGATTCTGG - Intronic
933008275 2:77023197-77023219 GGCTGGAGTGGCTGAGATGCAGG + Intronic
935965472 2:108468752-108468774 GGATGAACTGAATTAGAAGCAGG - Intronic
936779698 2:116017143-116017165 GGCTTACCTGGTAAAGATGCAGG - Intergenic
938630416 2:133160642-133160664 GGCTGAAGAGCTTTCGATGCTGG - Intronic
946988595 2:225302662-225302684 GGCTGAAGTGGCTGGGATGCAGG - Intergenic
947112487 2:226733819-226733841 GCCTGAGCTGGTTTTGATGGTGG - Exonic
1168908040 20:1422589-1422611 AGTTGAACTGGCTTATATGCTGG - Intergenic
1172935496 20:38617153-38617175 AGCTGACCTGGTTTGGCTGCTGG + Intronic
1175364742 20:58445027-58445049 GGGTGAACTGGTATTGCTGCTGG + Exonic
1178720303 21:35002810-35002832 GCCTGACATGTTTTAGATGCTGG - Intronic
1179460632 21:41532592-41532614 GGCTGAAAAGGTTTAGAAACAGG + Intergenic
1181298891 22:21865145-21865167 GTCTGAAGTTGTTTAGATGTGGG - Intronic
1183780900 22:39998229-39998251 GACTGAGATGGTTTACATGCAGG + Intronic
1185015211 22:48338909-48338931 GGCTGCACTGGTGCAGAGGCCGG - Intergenic
953798052 3:46000573-46000595 GGCTGAACTGGTACAGACACAGG + Intergenic
955986665 3:64580836-64580858 GGCTGAACTGGTTTCTATTCAGG + Intronic
959004879 3:101008730-101008752 GGCTGAAGTGGCTGGGATGCAGG + Intergenic
959989225 3:112612265-112612287 GGCTAGTCTGGTTTGGATGCTGG - Intronic
960736464 3:120786003-120786025 GGCTGAACTAGTTTACATTCTGG + Intergenic
961731458 3:128968205-128968227 AACAGAACTGGTTTGGATGCTGG - Exonic
962770503 3:138606871-138606893 GGCTGCTATGGTTTGGATGCTGG - Intergenic
963363247 3:144303384-144303406 GGCTGGAGTGGCTGAGATGCAGG + Intergenic
963810541 3:149772410-149772432 GGCAGGACTGGTTGAGATGGAGG - Intronic
972285351 4:37642864-37642886 GGCTGAACAGGTGCAGGTGCCGG + Intronic
972829918 4:42802872-42802894 AGCTGAAGTGGTTGGGATGCAGG + Intergenic
973812795 4:54588434-54588456 AGCTGAACTGATTCAGAAGCTGG + Intergenic
973838656 4:54838038-54838060 TGCTGAACATATTTAGATGCTGG + Intergenic
974608472 4:64184080-64184102 AGCTGAAGTGGCTGAGATGCAGG + Intergenic
975692474 4:76979469-76979491 GGCAAAACTGGTTTGAATGCTGG + Intronic
980747736 4:137041671-137041693 GGCTGACCTAGTCTAGAGGCTGG - Intergenic
983738575 4:171095764-171095786 GGCTGAAATGATTCAGATACAGG + Intergenic
992940997 5:81761318-81761340 TGCTAAATTGGTTTAGATGCTGG - Intergenic
993703539 5:91144750-91144772 AGCTTAACTGTTTTAGAAGCTGG - Intronic
998021296 5:138773663-138773685 GCCTTAACTCGTTTAGAAGCAGG + Intronic
998127899 5:139636530-139636552 GGCAGAACTAGTTTTGCTGCTGG + Intergenic
998420884 5:141985452-141985474 GACTGAACTTGTTCAGATTCTGG - Intronic
1000533707 5:162455195-162455217 GGCTGAAGTGGTTTGGAAGGAGG + Intergenic
1003849678 6:10208997-10209019 GGATAAACTGTTTTAGATGGTGG - Intronic
1007187074 6:39981014-39981036 GGATGTACTGTTTTAGATGAAGG + Intergenic
1011363672 6:86555742-86555764 GGATGGCCTGGTCTAGATGCTGG - Intergenic
1012940481 6:105409856-105409878 AGCTGAAGTGGCCTAGATGCAGG + Intergenic
1013718168 6:112989213-112989235 GGCTGGACTAATTTAGATGCTGG + Intergenic
1014068165 6:117150859-117150881 GGCTGGAGTGGCTTGGATGCAGG + Intergenic
1014107672 6:117585090-117585112 GGCATAACTGGTTTAAATACTGG + Intronic
1016540561 6:145159487-145159509 GGCTGTAGTGGTTCACATGCAGG - Intergenic
1016635892 6:146289789-146289811 GGCTGCACAGATTTATATGCTGG + Intronic
1017802710 6:157912043-157912065 GTCTGAACTGGGTTAGAAGCAGG - Intronic
1022134361 7:27433540-27433562 GGGTGAACTGGTTATGATGGTGG - Intergenic
1022837610 7:34132357-34132379 GGCAGAACTGGCTTCGATCCTGG - Intronic
1022837625 7:34132408-34132430 GGCAGAACTGGCTTCGATCCTGG - Intronic
1028986673 7:97015054-97015076 AGCTGGACTGGTTTATATGGGGG - Intergenic
1029449042 7:100630721-100630743 GGCTGAACTGGGTCTGATGGTGG - Intronic
1030110496 7:106022587-106022609 GGCTGGACTGGAGTAGCTGCAGG + Intronic
1030377978 7:108775749-108775771 GGCTGAACTGTTTGACAGGCTGG - Intergenic
1033212904 7:139473443-139473465 GGCTGAGCTTTTTTAGAGGCAGG - Intronic
1037202467 8:16274526-16274548 TGCAGAACTGCTTTAGATACAGG + Intronic
1037296729 8:17409732-17409754 GGCAGATCTGATTTAGATGGGGG + Intronic
1038909638 8:31948520-31948542 TGCTGGGCTGGTTTAGATGGAGG + Intronic
1040974298 8:53172865-53172887 GGCAGTAATGTTTTAGATGCTGG + Intergenic
1045331171 8:101157089-101157111 GCCTGACCTGGTTTTGATGGTGG + Intergenic
1046052917 8:109044809-109044831 GGCTGGAATGGTTGGGATGCAGG + Intergenic
1047928192 8:129701510-129701532 GGCTGAGCTGGTGTGGATCCTGG - Intergenic
1051281313 9:15444049-15444071 GGCTGAACTGGTTTAGATGCAGG - Intronic
1051876458 9:21799552-21799574 GTCTGAACTGGTATAAATTCAGG - Intergenic
1055715037 9:79108526-79108548 GGCTGGAGTGGTTGGGATGCAGG - Intergenic
1056172939 9:84005724-84005746 GGATGACTTGGTTTAGATTCTGG + Intergenic
1058205178 9:102096785-102096807 GGCTGCTCTGGTTTAGCTGTAGG - Intergenic
1058447084 9:105064072-105064094 GGCTGAAAGGGCTGAGATGCGGG - Intergenic
1059839803 9:118201200-118201222 GGCTGAACTAATTTACATTCAGG + Intergenic
1203396841 Un_KI270519v1:26711-26733 GGTTGAACTCCTTTAGATGAAGG + Intergenic
1187072385 X:15901165-15901187 GGCTGGACTGGCTGGGATGCAGG + Intergenic
1187276236 X:17818612-17818634 GGCTGAAATATTTTAGAGGCAGG + Intronic
1187670990 X:21665705-21665727 TGCAGAACTTGTTAAGATGCAGG + Intergenic
1188749231 X:33885063-33885085 GGCTGGAGTGGCTGAGATGCAGG - Intergenic
1189788693 X:44583213-44583235 GGCTAGAGTGGCTTAGATGCAGG - Intergenic
1193196132 X:78633602-78633624 GGCTGAACTAATTTACATTCTGG + Intergenic
1194688728 X:96956259-96956281 GGCTGAAGTGGCTAGGATGCAGG + Intronic
1195717652 X:107832623-107832645 GGCTAATTTGGTTTAGATCCAGG + Intronic
1198566501 X:137910667-137910689 TGCTGACCTGGTTTACTTGCTGG + Intergenic
1198608670 X:138373024-138373046 GGCTGGAGTGGCTTGGATGCAGG - Intergenic
1199704421 X:150411517-150411539 GGCTGAACTGGACTTGCTGCTGG - Intronic