ID: 1051281852

View in Genome Browser
Species Human (GRCh38)
Location 9:15449242-15449264
Sequence TTGAGCAATGTTCAGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051281852_1051281855 -1 Left 1051281852 9:15449242-15449264 CCAACCATCTGAACATTGCTCAA 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1051281855 9:15449264-15449286 AAGCAGTTTGAGTCAGATCTGGG No data
1051281852_1051281857 18 Left 1051281852 9:15449242-15449264 CCAACCATCTGAACATTGCTCAA 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1051281857 9:15449283-15449305 TGGGAATCGGTCTTACCTTCAGG No data
1051281852_1051281856 5 Left 1051281852 9:15449242-15449264 CCAACCATCTGAACATTGCTCAA 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1051281856 9:15449270-15449292 TTTGAGTCAGATCTGGGAATCGG No data
1051281852_1051281854 -2 Left 1051281852 9:15449242-15449264 CCAACCATCTGAACATTGCTCAA 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1051281854 9:15449263-15449285 AAAGCAGTTTGAGTCAGATCTGG No data
1051281852_1051281858 27 Left 1051281852 9:15449242-15449264 CCAACCATCTGAACATTGCTCAA 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1051281858 9:15449292-15449314 GTCTTACCTTCAGGAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051281852 Original CRISPR TTGAGCAATGTTCAGATGGT TGG (reversed) Intronic
901659674 1:10790661-10790683 TTGAACTTCGTTCAGATGGTGGG + Intronic
902652857 1:17847942-17847964 ATGAGTAATGTACAGATGGATGG - Intergenic
902679404 1:18032473-18032495 ATGAGCAATTTTCAGGTAGTAGG - Intergenic
905081794 1:35328965-35328987 TTGGGCAATGAGTAGATGGTAGG - Intronic
906091480 1:43183184-43183206 TTGAAGGATGTTCAGTTGGTAGG + Intronic
907273446 1:53304169-53304191 TGGAGCAATGTTGAGAAGGCTGG - Intronic
909568755 1:77084506-77084528 TTAAGCAAGGTACAGATGGTGGG - Intergenic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
911182796 1:94876008-94876030 ATGAGCAGTGTTCAGATGTGGGG + Intronic
912627348 1:111216510-111216532 TTGAGCAACTTTCAAATGGCAGG - Intronic
915025006 1:152819721-152819743 TTACACAATGTCCAGATGGTGGG - Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
917533289 1:175855929-175855951 CTGACCACTCTTCAGATGGTGGG - Intergenic
1062820223 10:529121-529143 TAGAAGAATGTTCAGATTGTGGG - Intronic
1066689780 10:38014672-38014694 TTGGGCTATGTTCTGTTGGTTGG + Intronic
1067245498 10:44538402-44538424 TAGAACAAAGTTCAGAGGGTGGG - Intergenic
1068505096 10:57890636-57890658 TTGAGGAATGTGCAGATCATGGG + Intergenic
1070897484 10:79996895-79996917 TTGTTCAATGTTCAGCTTGTAGG + Intergenic
1073804935 10:107087593-107087615 TTGAGCATTGACCAGGTGGTAGG - Intronic
1074560460 10:114530964-114530986 TTGAGCAGTTTTCAGATGCCTGG + Intronic
1074788162 10:116859947-116859969 TTGAGCAATCTTCCCATGGGAGG + Intronic
1078511211 11:11985534-11985556 TTGCAAAATGATCAGATGGTGGG - Intronic
1078938863 11:15977812-15977834 TTGAGGAAAGTTAAGAAGGTAGG - Intronic
1079647128 11:22879271-22879293 TTGAGCACAGTGCACATGGTGGG + Intergenic
1083640393 11:64142190-64142212 TTGAGAGTTGGTCAGATGGTGGG - Intronic
1083760514 11:64814190-64814212 TTGAGCAATATTGTGAAGGTGGG - Intergenic
1084445141 11:69199288-69199310 TAGAGCAATGGTGAGATGGAGGG - Intergenic
1087309516 11:96523820-96523842 ATGTGAAATGTTCAGATGTTTGG + Intergenic
1094071063 12:26413155-26413177 TTGAGCAATGTTCAGAAAATTGG - Intronic
1094622065 12:32089267-32089289 TTGAGCAATGTGGACAGGGTGGG - Intergenic
1097502932 12:60428756-60428778 TTGAACAATGTTGAGATCATTGG - Intergenic
1098002426 12:65959614-65959636 TTCAGGAATGTTCAGATGAAAGG - Intronic
1100655724 12:96642858-96642880 TTAAGAACTGTTCAGATGATAGG + Intronic
1100831906 12:98524104-98524126 TTTAGAAATGTTTAGATGCTTGG + Intronic
1105953607 13:25257271-25257293 TGGTGCATTGTTCCGATGGTTGG - Exonic
1107325087 13:39233157-39233179 TTGAGAAATGTTCTGATGTGGGG + Intergenic
1110422603 13:75329814-75329836 TTGAGCAATGCTAAGATATTTGG - Intronic
1111394683 13:87649786-87649808 ATGAGAGATGTTCAGATAGTTGG - Intergenic
1117851903 14:59981639-59981661 TTAAGAAATGTTCAGTGGGTGGG + Intronic
1118433723 14:65749500-65749522 TTGAGCAATTTTCTGGTGGATGG - Intergenic
1120414423 14:84201368-84201390 TTGTGACATGTTCAGTTGGTGGG + Intergenic
1120561282 14:85996116-85996138 CTGTGCAATATTCAAATGGTTGG + Intergenic
1128517846 15:68354481-68354503 GTGAGCCATGTAAAGATGGTGGG - Intronic
1129248597 15:74295595-74295617 GTGAGCAAGGGGCAGATGGTAGG + Intronic
1129802985 15:78430475-78430497 TAGAGCAATGATGAGAGGGTTGG + Intergenic
1130020330 15:80225037-80225059 TTCAGAAATGTTCAGAAGGCCGG - Intergenic
1140279196 16:73539350-73539372 TTTAGAAATGTTCAGGGGGTTGG - Intergenic
1150722742 17:67627323-67627345 TTGTGATTTGTTCAGATGGTGGG + Intronic
1151254195 17:72862995-72863017 TTGAGCAAAGTGCAGATTCTTGG + Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152853948 17:82653258-82653280 TGGAGCAATGTTAAGATTGCTGG + Intergenic
1159101616 18:63964686-63964708 TTTAGCTATGTTCACATGGCAGG + Intronic
927531431 2:23807142-23807164 TGGAGCAATGATCAGATCATGGG + Intronic
929234174 2:39589051-39589073 TTAAGAAATGTTCAGAGGGCTGG - Intergenic
932089377 2:68791313-68791335 TTGAGCACTGTTTAGATTCTAGG - Intronic
932388351 2:71359587-71359609 TTGAGGGATGCTTAGATGGTTGG - Intronic
936574825 2:113644197-113644219 CTGAGCAATGTACACATGGGTGG - Intergenic
936697167 2:114964932-114964954 TTGAGAAATGTTAAGATTTTTGG + Intronic
936790922 2:116150525-116150547 TTGAGGGATGTTGAGATGGCTGG - Intergenic
938815806 2:134903005-134903027 TGGAGCAATAAGCAGATGGTGGG - Intergenic
941191564 2:162390522-162390544 ATGAGCATTGTTAAGATGGCTGG - Intronic
942442442 2:176050321-176050343 TTGAGAAATATTTGGATGGTAGG + Intergenic
944706973 2:202299867-202299889 TTGAGCAGTGTTCTGAAAGTTGG + Intronic
948962672 2:241353079-241353101 TTGAGTAATTTTCTGATGGGAGG + Intronic
1168769077 20:402782-402804 TTGAGAAATGTTCTGGTTGTGGG - Intergenic
1169035224 20:2445259-2445281 TTAAGCAATCCTCAGATTGTTGG - Intergenic
1169820996 20:9709893-9709915 TTGTGCAATGTCCATAGGGTAGG - Intronic
1169850043 20:10038133-10038155 TTAAGAAATGTTCAGAAAGTAGG - Intronic
1172783763 20:37452388-37452410 TTGAGCAAAGGCCAGAAGGTGGG - Intergenic
1173454984 20:43194686-43194708 TTGAGTAATGTTTTGATGGCAGG + Intergenic
1175508023 20:59500792-59500814 TTGAGTAATGTTCTCACGGTAGG - Intergenic
1175956888 20:62615679-62615701 ATGATGAAAGTTCAGATGGTGGG + Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176606298 21:8835304-8835326 TTGTGTAATGTTCAAATGTTGGG - Intergenic
1177917307 21:27105560-27105582 TTGGGCAATGTTCAGCTTCTAGG + Intergenic
1178194965 21:30334129-30334151 TTGATCTATGTTCACATGATTGG + Intergenic
1178396811 21:32250139-32250161 TTGAACTAGGTTCAGATGTTGGG - Intergenic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1181311828 22:21949076-21949098 TTGAGGCATGTGCAGATAGTGGG - Intronic
1183662763 22:39231176-39231198 TTGAGAAAGGCTCAGATGGGTGG - Intronic
1185425348 22:50766679-50766701 CTGAGCAATGTACACATGGGTGG + Intergenic
949229224 3:1730743-1730765 TGGAGCAATGGTCTGAAGGTGGG - Intergenic
950677126 3:14561081-14561103 ATGAGCAAGCTTCAGATGGCTGG - Intergenic
952557074 3:34544324-34544346 TTGAGCAATAATCAGAAAGTTGG + Intergenic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
957607750 3:82425194-82425216 TTCAGAAATGTTCAGAAGATTGG - Intergenic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959332150 3:105020083-105020105 CTGAACAATGTTCAGAAAGTAGG - Intergenic
960558344 3:119054416-119054438 TTGAGCATTTTTCACATGTTTGG - Intronic
962883820 3:139604276-139604298 TTGAGGAATGTTCAGGTTGGTGG + Intronic
965363588 3:167770890-167770912 ATCAGCAAGGTCCAGATGGTGGG - Intronic
967213078 3:187185966-187185988 TTGAGAAACGCTCAGGTGGTAGG + Intergenic
969347784 4:6580155-6580177 TTGAGCAAAGTCCAGATGTAAGG - Intronic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
973034780 4:45392022-45392044 GTGGGAAATGTTCAGATGATTGG - Intergenic
974468751 4:62292089-62292111 TTCATCAATGTTCAGGTGATAGG - Intergenic
979537362 4:121838604-121838626 ATCAGCAAAATTCAGATGGTAGG + Intronic
981363000 4:143869131-143869153 TTAATCAATCTTCACATGGTAGG + Intergenic
981373728 4:143989938-143989960 TTAATCAATCTTCACATGGTAGG + Intergenic
981382830 4:144093191-144093213 TTAATCAATCTTCACATGGTAGG + Intergenic
982122674 4:152157577-152157599 TTAAGCAATGTTGACATGCTTGG + Intergenic
989814256 5:45717173-45717195 TTTAGAGATGTTCAGATAGTTGG + Intergenic
999377037 5:151094060-151094082 TTGGGCACTGTCCAGAGGGTGGG - Intergenic
1000855375 5:166391527-166391549 TTGAGCAAGGTTCGGATATTTGG + Intergenic
1001203527 5:169741119-169741141 CTCAGCAATGGTCAGATGGCTGG - Intronic
1004008661 6:11659905-11659927 TTGAGTGATGTTCAGTTGCTGGG - Intergenic
1007794490 6:44336815-44336837 TTCAGCAATGTTCAGAGATTTGG + Intronic
1011388305 6:86821672-86821694 TTCATCAATGTTCAGCTGTTTGG - Intergenic
1021041397 7:15866398-15866420 TTGAGAAGTGTTGAAATGGTTGG + Intergenic
1021566973 7:22025705-22025727 TGGAGCAATGGTGAGCTGGTGGG - Intergenic
1021927844 7:25550492-25550514 CTGAGCAGTGTTCTGATGGATGG - Intergenic
1023683126 7:42708825-42708847 TTGAGCATTTTTCAGATGTTTGG + Intergenic
1023759614 7:43452486-43452508 TTTAACAATATTCAGTTGGTAGG - Intronic
1026960456 7:74404379-74404401 TTGAAGAAGGTTCAGAAGGTGGG - Exonic
1028834240 7:95356944-95356966 TTCAGCAATTTTCAGAATGTGGG - Intergenic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1031770324 7:125833461-125833483 TTGAGCACAGCTCAGCTGGTGGG + Intergenic
1031902214 7:127423748-127423770 TTTGTCAATGATCAGATGGTTGG + Intronic
1032092477 7:128917916-128917938 TTGAGGAATATTCACCTGGTGGG + Intergenic
1033509026 7:142036075-142036097 TTAAGCAAGGTTCAGTTGGGAGG + Intronic
1033577032 7:142695320-142695342 TTTAGGAATGTTGATATGGTAGG + Intergenic
1043707784 8:83375019-83375041 TTGAGCAATTTTCAGAAGTTTGG + Intergenic
1045987987 8:108272301-108272323 TTGAGCAATGATCACATTGCTGG - Intronic
1050711147 9:8465307-8465329 TTGAGCAATGTTCAAAGAGTAGG + Intronic
1050873328 9:10603722-10603744 TTGAGAAATCTTCAGATAGAAGG - Intronic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1057268000 9:93631522-93631544 TTGAGCAATAACCAGATGATAGG - Intronic
1058499271 9:105593830-105593852 TTTAGCAATGTTCAGGTCATTGG + Intronic
1186658288 X:11640309-11640331 TTTTGTAATGTTCAGATGGGAGG - Intronic
1187115082 X:16341186-16341208 TTCACCAAAGATCAGATGGTTGG + Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1194789831 X:98133674-98133696 TTGAGCACAGTTCAGATTTTTGG - Intergenic
1194808929 X:98366102-98366124 TTGAGAACTGTGTAGATGGTGGG + Intergenic
1195578636 X:106477509-106477531 TTGAGAGATGTCTAGATGGTTGG + Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1200769286 Y:7108664-7108686 TAGAGAAAGGTTCAGGTGGTGGG - Intergenic