ID: 1051283369

View in Genome Browser
Species Human (GRCh38)
Location 9:15466895-15466917
Sequence GCTTACAAAACAATAATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051283366_1051283369 14 Left 1051283366 9:15466858-15466880 CCCTTGCGAAGGAATCCAATGGA 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG 0: 1
1: 0
2: 3
3: 16
4: 261
1051283368_1051283369 -1 Left 1051283368 9:15466873-15466895 CCAATGGAAAAACTTTGTTAAAG 0: 1
1: 0
2: 5
3: 28
4: 309
Right 1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG 0: 1
1: 0
2: 3
3: 16
4: 261
1051283367_1051283369 13 Left 1051283367 9:15466859-15466881 CCTTGCGAAGGAATCCAATGGAA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG 0: 1
1: 0
2: 3
3: 16
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051283369 Original CRISPR GCTTACAAAACAATAATTGA AGG Intronic
901984506 1:13063613-13063635 TCTTACAAAACCACAATTGTAGG - Intronic
901997304 1:13163157-13163179 TCTTACAAAACCACAATTGTAGG + Intergenic
906539328 1:46572964-46572986 GCCAACAAAACAATAATGAATGG - Intronic
907373049 1:54015394-54015416 GCTTACAAAATAATAAAAGAAGG + Intronic
908586473 1:65575539-65575561 ATTTATAAAACAATATTTGAGGG - Intronic
909096982 1:71299707-71299729 GTTTTCAAATCATTAATTGAAGG + Intergenic
910356923 1:86368257-86368279 ACTTTCAAAAAAATAAGTGAAGG - Intronic
915684815 1:157622262-157622284 GTGTACAACACAATAATTAATGG + Intergenic
917605679 1:176626530-176626552 ACTGACAAAACAAACATTGAAGG + Intronic
918564466 1:185912062-185912084 GCTTACAAAATAATCAGAGATGG + Intronic
918617735 1:186566150-186566172 GGTTATAAAACAACAATTGTGGG - Intergenic
918642450 1:186859630-186859652 GCTTTCAAAAATATAATTGTAGG + Intronic
919558372 1:199090020-199090042 GGTTTCAAAACATTCATTGAAGG + Intergenic
920778355 1:208963364-208963386 GCAAACAAAACAATCATTAAAGG - Intergenic
920781716 1:208998148-208998170 ACTTACAAAACATCATTTGAGGG - Intergenic
920991073 1:210940558-210940580 CCATAGAAAACAATCATTGAAGG + Intronic
921437942 1:215148846-215148868 GATTTCAACACGATAATTGAAGG + Intronic
921471377 1:215554520-215554542 GATTCCAATACAATAATTGGTGG - Intergenic
922378394 1:224994284-224994306 GGTTACAATACAATAATAGTAGG - Intronic
922993212 1:229933137-229933159 GCATACAAATCAAAGATTGATGG + Intergenic
923187852 1:231591232-231591254 TTTTAGAAAACAATAAATGACGG - Intronic
923789531 1:237100143-237100165 GCTTACTAAAGAATAAGTGGGGG + Intronic
1064949210 10:20828476-20828498 TCTTACAAAACAAAATTTCAAGG + Intronic
1065160837 10:22919661-22919683 GCTCAGAAAACAAAAAATGAGGG - Intergenic
1065937288 10:30531945-30531967 GCTTACAAAACACAAATTCAAGG + Intergenic
1066162861 10:32752966-32752988 ACTTACAAGAGATTAATTGATGG + Intronic
1069200680 10:65611508-65611530 AATTATAAAATAATAATTGAAGG + Intergenic
1070276055 10:75008077-75008099 ACTTAGAAAAACATAATTGAAGG + Intronic
1073825018 10:107311021-107311043 GCTTACAGAATAACAAGTGAAGG + Intergenic
1075034277 10:119050156-119050178 TATTACAAAACTATAGTTGAGGG - Intronic
1076286982 10:129309760-129309782 TCATACAAGAAAATAATTGAGGG + Intergenic
1077724871 11:4664106-4664128 GCTTATAAAACAATCATGCAAGG + Intergenic
1077813225 11:5659697-5659719 GCTTACAAAACAATAAAACCTGG - Intergenic
1078975168 11:16465926-16465948 GCTTACAAAAGAAGAAGAGATGG - Intronic
1080258237 11:30317330-30317352 GCTTTCAAAATCAAAATTGAAGG - Intergenic
1082176660 11:49067747-49067769 CCATAGAAAACCATAATTGAAGG - Intergenic
1082843702 11:57710694-57710716 TCTTAAAAAAAAAAAATTGAGGG - Intronic
1083448260 11:62725502-62725524 GCAGATAAAAAAATAATTGAAGG - Intronic
1085215067 11:74822276-74822298 GCTTACAAAACACTGCTTAAAGG - Intronic
1086699804 11:89888049-89888071 CCATAGAAAACCATAATTGAAGG - Intergenic
1086706366 11:89956467-89956489 CCATAGAAAACCATAATTGAAGG + Intergenic
1086751426 11:90499090-90499112 TCTTACAAAACAAAAAATAAGGG - Intergenic
1091894798 12:4092551-4092573 ACTTACAAAAAAATAAATGAGGG - Intergenic
1091990294 12:4949863-4949885 TTTTACAAAATAATAATAGAAGG + Intergenic
1092514993 12:9202153-9202175 TTATACAAAACAAAAATTGAGGG - Intronic
1093720714 12:22438504-22438526 GCTTGGAAAACAATATTTGGGGG + Intergenic
1094253719 12:28397495-28397517 GATTAAAAAAAAAAAATTGATGG + Intronic
1094631591 12:32180762-32180784 GCTTACAAAACCAGTATTCAAGG - Intronic
1098672637 12:73250633-73250655 GACTACAATACAATAATAGAAGG + Intergenic
1099852376 12:88117732-88117754 ACTTAGAAAAGAATAATTTAAGG + Intronic
1100163509 12:91889959-91889981 GCTTCCAAAAAAATAATTGTAGG + Intergenic
1102698518 12:114818389-114818411 GCTTCTAAAACAATAATTGGCGG - Intergenic
1104233510 12:126908637-126908659 GTTTAGAAAACTGTAATTGATGG - Intergenic
1106439045 13:29749365-29749387 GCTTACAAACCAGCAATTGCAGG - Intergenic
1107000530 13:35539203-35539225 ACTTACCAAACTATAATTGTTGG - Intronic
1107239753 13:38218246-38218268 GCTAACAAAACAAAAAATTAAGG - Intergenic
1110213760 13:73003669-73003691 GCTTAGTAAACAATAATATAAGG + Intronic
1111012797 13:82333133-82333155 GTTTATAAAACAAAAATTCAAGG - Intergenic
1112409231 13:99147845-99147867 TCTTGCAAAACAATACTTAAGGG - Intergenic
1112607383 13:100920319-100920341 TATTAAAAAACAAAAATTGATGG - Intergenic
1114053843 14:18948483-18948505 GCTTACTAAAAAATAAGTAAAGG + Intergenic
1114108712 14:19453442-19453464 GCTTACTAAAAAATAAGTAAAGG - Intergenic
1114238249 14:20841584-20841606 ACTTACCCAACATTAATTGAGGG + Intergenic
1114494800 14:23125493-23125515 CTTTACAAAAAAATAATTGAAGG + Exonic
1114573327 14:23691066-23691088 ACTTACAAGACAGTAACTGAAGG - Intergenic
1114889656 14:26902236-26902258 AATTATAAAACAATAATTTAGGG - Intergenic
1115057572 14:29149163-29149185 GTTTACAAAACACTAACTGCAGG + Intergenic
1116709608 14:48350435-48350457 GGTTACAAAGCAAAAAATGATGG + Intergenic
1118149062 14:63168812-63168834 GATTACAATACAATAATAGTAGG + Intergenic
1119796242 14:77400148-77400170 CTTTACCAAACAAAAATTGAGGG + Intronic
1120879910 14:89407478-89407500 GTATACATAAGAATAATTGACGG - Intronic
1120983090 14:90308500-90308522 GCTTAAAAGACAATGATTGGGGG + Intronic
1121569930 14:94939916-94939938 GCTTTAATAACAATAATTTAAGG - Intergenic
1125305370 15:38306357-38306379 GCTCAGAAAACAATAATGGCAGG + Intronic
1126035574 15:44542309-44542331 GCTTACAGAACACAAATTAAAGG + Intronic
1126282581 15:46972682-46972704 GTTTAAAAAAAAAGAATTGAAGG + Intergenic
1126296614 15:47144752-47144774 GATTACAATACAATAATAGTAGG + Intergenic
1127863988 15:63016866-63016888 TGTTACACAACAATAATTGCAGG - Intergenic
1127902706 15:63352785-63352807 CCTTACAAAACAAACTTTGAGGG - Intronic
1128860953 15:71071542-71071564 AATTACAAAAGAATAATTGCTGG + Intergenic
1129094262 15:73186217-73186239 GTTTAAAAAAAAATAATTAAGGG + Intronic
1129449280 15:75641109-75641131 TTTTACAATACAATATTTGAGGG + Intronic
1129774517 15:78227341-78227363 GCCTACAAATCAATAATAAAAGG + Intronic
1130773862 15:86955346-86955368 GCTAACAAAATAGTACTTGAAGG + Intronic
1130788396 15:87124967-87124989 TCTTACAAAAGAAAAATTGGGGG - Intergenic
1131938213 15:97531559-97531581 GCTTGCAAAACAGAAATTGATGG + Intergenic
1137827802 16:51514642-51514664 GCTTCCAAAACAGTATTGGAAGG - Intergenic
1138864178 16:60796255-60796277 GCTCACAAAACTGTAATTCAGGG + Intergenic
1138923392 16:61560459-61560481 CCTTACAAAAACATGATTGAAGG + Intergenic
1139004689 16:62556008-62556030 GATTCCAATACAATAATAGAGGG - Intergenic
1140511749 16:75513553-75513575 GCTTACAGAAGAAACATTGAGGG - Intergenic
1142562223 17:817019-817041 GCTTTCCAAACAAAAGTTGAGGG - Intronic
1142936393 17:3336837-3336859 ACTCAGAAAACATTAATTGATGG - Intergenic
1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG + Intergenic
1150015109 17:61548765-61548787 GTTTCCAAAACAATAAATAAAGG - Intergenic
1150071592 17:62155480-62155502 GGTTAATAAACAATATTTGAAGG - Intergenic
1151620403 17:75241450-75241472 TCTTACAAAACAATTATTGAAGG - Exonic
1153541716 18:6163115-6163137 TCTAACAAAACAACATTTGAGGG - Intronic
1155193099 18:23448737-23448759 GTTTACAAAACCATTATTCATGG - Intergenic
1155411759 18:25553905-25553927 TCTTACAAAACTATAATTGCAGG + Intergenic
1155587206 18:27380406-27380428 GCTTACAAAGTAGTATTTGAAGG - Intergenic
1155642634 18:28037967-28037989 GCATAGAAAACGGTAATTGAAGG + Intronic
1160464079 18:79061149-79061171 CATTACAAAGCAGTAATTGAGGG + Intergenic
1161547276 19:4889202-4889224 GCTTAAAAATCATTCATTGATGG - Intergenic
1165168996 19:33877795-33877817 AGTTACAATAAAATAATTGATGG + Intergenic
1165409715 19:35651865-35651887 GCTTAAAAAAAAATCATTGTAGG - Intronic
1165579203 19:36847826-36847848 GCTTTCAAAAAAAGGATTGAGGG + Intronic
1165639653 19:37373606-37373628 GCTGAGAAAAAAATAATTCAGGG + Intronic
1168011104 19:53533595-53533617 GACTGCAATACAATAATTGAAGG - Intronic
925983753 2:9198237-9198259 GCTTACAACTCAATAATAAAAGG - Intergenic
929205968 2:39293575-39293597 ACTGACAAAACAATAATTGCAGG + Intronic
930385924 2:50694860-50694882 GCTTATAAAAAATTAATTGCGGG + Intronic
931445045 2:62319969-62319991 GCTTAAAAAATAATAAATAAAGG + Intergenic
934538249 2:95154677-95154699 GTTTGCAAAACAAAAATGGAAGG + Intronic
934584482 2:95478700-95478722 CCATAGAAAACCATAATTGAAGG + Intergenic
934594970 2:95598015-95598037 CCATAGAAAACCATAATTGAAGG - Intronic
934787796 2:97027501-97027523 CCATAGAAAACCATAATTGAAGG + Intergenic
935868830 2:107422857-107422879 GATTTCAAAACACTAATTAAAGG + Intergenic
936117482 2:109713569-109713591 GCTTACCAAACACAAATTCATGG - Intergenic
936653974 2:114462930-114462952 GCTTACAAAACAAAAATGATAGG - Intronic
936852648 2:116919505-116919527 ACTTTCAAAACAATCTTTGAAGG + Intergenic
938471832 2:131571240-131571262 GCTTACTAAAAAATAAGTAAAGG + Intergenic
939240508 2:139552738-139552760 TCTGACAAAATAATCATTGATGG - Intergenic
939411753 2:141835983-141836005 GATTACAAAACAGAAATAGAAGG + Intronic
940895476 2:159078513-159078535 GGTTACAAAGCAATATTTCATGG + Intronic
941073820 2:160984954-160984976 GTTTACAAAAGAATAACTTAAGG + Intergenic
942242273 2:173973748-173973770 AATTATAAAACAATAATAGATGG + Intergenic
942756469 2:179347394-179347416 GCTTTCACAACAGAAATTGATGG + Intergenic
944596203 2:201263632-201263654 CCTCAGAAAAAAATAATTGAGGG + Intronic
945201400 2:207285318-207285340 GCTTACAAAGCAATTAGTGCAGG - Intergenic
947075219 2:226335633-226335655 GCCTACAAAATAATAATACATGG - Intergenic
947255779 2:228162421-228162443 GCTTACCAATCAGTAATTAAGGG - Intronic
1169964670 20:11203136-11203158 GCATATAAATCAAAAATTGATGG + Intergenic
1169987893 20:11467144-11467166 GAGTACAAAACAATAATAGTGGG - Intergenic
1170394604 20:15912391-15912413 GCTTACAAAACAACACTGCAAGG - Intronic
1170690444 20:18610607-18610629 GCTTAAAAAACCAGAATTTATGG + Intronic
1171192272 20:23167015-23167037 TGTTAGAAAACACTAATTGATGG + Intergenic
1174002229 20:47383235-47383257 GCTTGCTAAACACTGATTGAGGG + Intergenic
1175016297 20:55794655-55794677 GGTTAAAAGACAAAAATTGAGGG - Intergenic
1175412983 20:58783801-58783823 AGATACAAAACAATAATTGGAGG - Intergenic
1176678367 21:9802260-9802282 GAATACCAAACATTAATTGAGGG - Intergenic
1177084559 21:16687343-16687365 GCTTACAAAACCATTTTTGTAGG - Intergenic
1177800823 21:25826997-25827019 GCTTACACAACAAGAATAGATGG + Intergenic
1178268908 21:31171501-31171523 TCTTACAAATCAATAATTGGCGG + Intronic
1178309586 21:31518585-31518607 GCTTAAAAAACACTCATTTAGGG - Intronic
1180021243 21:45128927-45128949 CCTAAGAAAATAATAATTGATGG - Intronic
1180472313 22:15670864-15670886 GCTTACTAAAAAATAAGTAAAGG + Intergenic
1181535657 22:23541830-23541852 GCTTCCAAAACAAAAACTGGAGG + Intergenic
950975689 3:17241075-17241097 TTTTTCAAAACAACAATTGAAGG + Intronic
951411256 3:22370657-22370679 GATTACAAAACACTAACTGTGGG + Intronic
956029757 3:65024772-65024794 GCATACAAAACCATAACTAATGG + Intergenic
956209333 3:66787156-66787178 CCTTACTCAACAATTATTGAAGG + Intergenic
956535111 3:70267241-70267263 GAATGCAAAACAAGAATTGATGG + Intergenic
957280748 3:78148086-78148108 GTGTACAAATGAATAATTGAGGG + Intergenic
957288958 3:78252180-78252202 GTTTCTAAAATAATAATTGATGG + Intergenic
958035583 3:88166583-88166605 GCTTACAAAATAATGATTGTTGG + Intronic
958476557 3:94591331-94591353 GCTGACAAATAAATATTTGATGG + Intergenic
958581019 3:96023567-96023589 GCTGACAGAAGAATGATTGAGGG - Intergenic
958619379 3:96536804-96536826 GGTTGCAAAAAAATAATTTATGG + Intergenic
958757034 3:98261431-98261453 ACTTACAGAAAAATCATTGATGG - Intergenic
959070340 3:101695838-101695860 GCTTCCAAAACAAAAACTGGAGG + Intergenic
959244883 3:103852870-103852892 GCCTAGAAAACAATATTTGTTGG + Intergenic
959334553 3:105047865-105047887 GCTTACAAAATCATAATTTTGGG + Intergenic
959374965 3:105578118-105578140 GCTTTGAAAATAATAAATGACGG + Intergenic
960727735 3:120687657-120687679 TCTTAGAAAACTATAATTCAAGG + Exonic
963631459 3:147736100-147736122 TCTTTCAGAACAATAATTTAAGG + Intergenic
964213232 3:154251128-154251150 GTTTACAAAATAATGATGGAAGG - Intronic
964942378 3:162174711-162174733 GAAGACAAAAAAATAATTGAAGG - Intergenic
965180251 3:165393640-165393662 GCTTACATGACAAAAATTTAAGG - Intergenic
965474783 3:169142949-169142971 GTTTATAAAACAAAAATTAATGG + Intronic
965518072 3:169643661-169643683 GCTTCAAAAACATTAACTGAGGG + Intronic
967467288 3:189822633-189822655 GCTTCTGAAACAATTATTGAAGG - Intronic
970012653 4:11476847-11476869 GCTGACAAAACAAACAATGAGGG + Intergenic
970961445 4:21876323-21876345 GCTTACACACCCATAATTTAAGG + Intronic
971609550 4:28704830-28704852 GCATATAAAATAACAATTGAGGG - Intergenic
971722303 4:30261031-30261053 GCTTACAGAACAATGATAAAAGG - Intergenic
972065030 4:34931597-34931619 GCTTACAGTACAATATATGATGG + Intergenic
973940824 4:55908685-55908707 GTTTATAAAACTATAACTGATGG - Intergenic
974440982 4:61917137-61917159 GATCACACAATAATAATTGAAGG + Intronic
974765655 4:66342355-66342377 CATTACCAAAGAATAATTGAAGG - Intergenic
975434295 4:74333886-74333908 GGTTAGGAAACAATAATGGAAGG - Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
977034927 4:91937993-91938015 GATTACAATACAATAATAGTAGG + Intergenic
977251937 4:94698943-94698965 GCTTACAAGAGAATATTTAATGG + Intergenic
978112620 4:104980493-104980515 CCTTCCCAAACAAAAATTGAGGG + Intergenic
979091251 4:116485237-116485259 GGTTAAAAAACAATAAATGCTGG - Intergenic
979658877 4:123229245-123229267 GCTTAAAAATCAATAACTCAGGG - Intronic
980036718 4:127893024-127893046 TCATACAAAAACATAATTGAAGG - Intronic
980488842 4:133498250-133498272 GCTTATAAAACATTCTTTGAGGG + Intergenic
980586431 4:134822429-134822451 GGTTAAAAAACAATAAATGTTGG - Intergenic
980830263 4:138122853-138122875 GATTGCAATACAATAATAGAAGG - Intergenic
980985809 4:139693063-139693085 TATTACAAAACAATAAATGATGG + Intronic
981502394 4:145466124-145466146 TCATAAAAAACAATAATGGAAGG - Intergenic
981636736 4:146890136-146890158 GCTTAAACAACAAAAATTTATGG + Intronic
981866176 4:149422262-149422284 GCATACAAAGCAAGATTTGAGGG + Intergenic
981879084 4:149587288-149587310 GCTAAAAAAAGAATATTTGAAGG - Intergenic
981900908 4:149861509-149861531 GACTACAAAACAATAATAGTAGG + Intergenic
983949701 4:173625254-173625276 GATTCCAATACAATAATTGTTGG - Intergenic
983956110 4:173700560-173700582 GCAAACAAAACAATAATGAAAGG + Intergenic
984084450 4:175291770-175291792 GCTTACAACACAATACATGTAGG + Intergenic
985397189 4:189556709-189556731 GAATACCAAACATTAATTGAGGG + Intergenic
987100530 5:14587700-14587722 ACTTAAAAAACAAAAATAGAGGG - Intronic
987347720 5:16993368-16993390 GCTTTTAAAATAAAAATTGAAGG + Intergenic
987632328 5:20490915-20490937 GAATACAAAACATTAAATGATGG + Intronic
987910650 5:24139556-24139578 GTTTACAAAAGAATATTTGCAGG + Intronic
987933276 5:24429754-24429776 GCTCACAAAACAATACTCCAAGG - Intergenic
988615063 5:32767376-32767398 CCTTACAAAACATTCATAGATGG - Intronic
992237060 5:74720857-74720879 ACTTACAAAAAAATAATTCCTGG - Intronic
992982307 5:82188521-82188543 TATTAAAAAATAATAATTGATGG - Intronic
994533821 5:101001636-101001658 TCTTACAAAAAAATAATAAAGGG + Intergenic
994728256 5:103461993-103462015 ACTTACAAAACATAAATTCAAGG - Intergenic
995416115 5:111915197-111915219 GGTTTTAAAACAATGATTGATGG + Intronic
995625269 5:114069460-114069482 GCTTAGAAATCTATAGTTGAAGG - Intergenic
995639668 5:114240315-114240337 GCTTATAAAATAAGAATAGATGG + Intergenic
998958457 5:147460797-147460819 GCTTGCAATCCATTAATTGAAGG + Intronic
999160646 5:149494267-149494289 GCTTACAAATGAATATTTGGAGG - Intronic
1003067659 6:2917472-2917494 GCATACAAAACAATACTGGTGGG + Intergenic
1003538298 6:6995518-6995540 GCTTACAAATGACTAACTGAAGG + Intergenic
1004628874 6:17402468-17402490 TCTTAAAAAACAAAAAGTGAAGG + Intronic
1005617994 6:27593846-27593868 GCTTACAAAACATAAGTTTAAGG - Intergenic
1005875823 6:30008840-30008862 GCTTACAAAAGAGTAAGTGCTGG - Intergenic
1007046567 6:38781357-38781379 GCTTACAAAGAAATAATTGATGG - Exonic
1008247138 6:49190822-49190844 AATTACAAATCAATAATTAAAGG + Intergenic
1008320694 6:50109510-50109532 GGTAACCAAACAATAATTTAAGG + Intergenic
1010011085 6:71049421-71049443 GCTTATAAAGCTATAATTGAGGG + Intergenic
1010860932 6:80910406-80910428 ACTTTAAAAACAATAAATGATGG + Intergenic
1011447770 6:87460911-87460933 ACTTAAAAAACAATAATTTTTGG - Intronic
1011764191 6:90601748-90601770 TCTGAGAAAACAATTATTGAGGG - Intergenic
1012079620 6:94738843-94738865 GCCTATAAAACAATAACAGAAGG + Intergenic
1013431409 6:110059239-110059261 TCTTACAAAATAAGAATTTAAGG - Intergenic
1014530677 6:122555737-122555759 TCTTTCAAAACATTACTTGATGG + Intronic
1014977471 6:127905596-127905618 GTTCCCAAAACAATAATTAATGG + Intronic
1015831522 6:137375099-137375121 TCTTACTAAACAATAATTGAAGG - Intergenic
1016693273 6:146964030-146964052 TCTTATAAAACAGTATTTGATGG + Intergenic
1018165904 6:161096137-161096159 ACTTACAAAACAAAACTTAAGGG - Intronic
1020988984 7:15171957-15171979 ACTTACAAAACAAGTATTGAGGG + Intergenic
1022773107 7:33495624-33495646 ATTTAAAAAATAATAATTGATGG - Intronic
1023330295 7:39108269-39108291 GCAAAAAAAAAAATAATTGAAGG - Intronic
1024977883 7:55130680-55130702 GCTTACAAAACCATCACAGAGGG + Intronic
1025795014 7:64731564-64731586 TTTTACAAAAAAATAATTTAAGG + Intergenic
1027695873 7:81409667-81409689 GCTTATAAAACAAGAATTAGAGG + Intergenic
1031995430 7:128227316-128227338 GCTTACAAACGAAAAATTCAAGG + Intergenic
1032436699 7:131906720-131906742 GCTTAAAAAAAAAAAATTCAGGG - Intergenic
1032618779 7:133505058-133505080 GCTTTTAAAACAGTAATAGATGG + Intronic
1034328684 7:150262736-150262758 TCTTACAAAATAATAATAAATGG + Intronic
1037071728 8:14658836-14658858 GCTTAATAAACATGAATTGAAGG + Intronic
1037153143 8:15664032-15664054 GCTTACAATGCAATAATTCTGGG - Intronic
1038691354 8:29766289-29766311 GCTTTGAAAACCGTAATTGAAGG + Intergenic
1039653229 8:39367218-39367240 GCTAACAACTCAATAATTGAAGG + Intergenic
1039776467 8:40742521-40742543 ATTTAAAAAACAATAATTGGGGG + Intronic
1041975655 8:63796319-63796341 GCTTCTAAAACAATTATAGAAGG + Intergenic
1042429387 8:68687489-68687511 GCATACAAAACCATAAATTAGGG + Intronic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1042667693 8:71224325-71224347 TTTTACAAAACAAAAATGGAAGG + Intronic
1043503308 8:80877226-80877248 GCTTTCAAACCATTAAATGAAGG + Intergenic
1045921051 8:107529523-107529545 CCTTACAAACCATTAATGGAAGG - Intergenic
1046655558 8:116890410-116890432 GCTTATAAAACAGTCATTGTGGG - Intergenic
1047894790 8:129354484-129354506 GCTTTCCAAACCATAATTCACGG + Intergenic
1047970619 8:130081276-130081298 GGTCACAAGACAATAAATGAGGG + Intronic
1048145260 8:131835669-131835691 GCTAATAAAACTATAAGTGATGG - Intergenic
1050954715 9:11640337-11640359 TCCTACAAAACAATAATATAAGG - Intergenic
1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG + Intronic
1055661450 9:78507819-78507841 TCTTCCAAAGCAACAATTGAGGG - Intergenic
1055778085 9:79788237-79788259 GCTTGCTAAACATTTATTGATGG + Intergenic
1059252681 9:112900800-112900822 GCTTACAACTCAATAATAAAAGG + Intergenic
1061739397 9:132689484-132689506 GCATAAAAAACAAGAATGGAGGG - Exonic
1203663533 Un_KI270754v1:4799-4821 GAATACCAAACATTAATTGAGGG - Intergenic
1185925939 X:4146515-4146537 GCAATAAAAACAATAATTGAGGG - Intergenic
1187023349 X:15407312-15407334 GCTTACAGAACATTCAGTGAGGG - Intronic
1187633621 X:21202813-21202835 GCTTAGAAAAAAATAGCTGATGG + Intergenic
1188677068 X:32954656-32954678 GATTAAAAAAAAATAACTGATGG - Intronic
1189599292 X:42605227-42605249 GGTTAAAAATCAATAAATGATGG - Intergenic
1191148937 X:57199689-57199711 GATTACAACACAATAATAGCTGG - Intergenic
1192690718 X:73360404-73360426 GCTTACAAAACAAAAAAATAGGG - Intergenic
1192774507 X:74228367-74228389 ACTTACAAAAACAGAATTGAAGG + Intergenic
1193804319 X:85975683-85975705 GCTTACAGAAAAATAATAGTAGG + Intronic
1194627538 X:96243118-96243140 ACTTAAAAATCAATATTTGAAGG - Intergenic
1195922435 X:109996924-109996946 GGTTAGAAAACAATAAATAAGGG - Intergenic
1196071885 X:111533794-111533816 GAATACAATACAATAATAGAAGG - Intergenic
1198704257 X:139430510-139430532 TTTTAAAAAATAATAATTGATGG - Intergenic
1200203771 X:154301154-154301176 GGTTAGAAATCAATAATAGATGG - Intronic