ID: 1051286880

View in Genome Browser
Species Human (GRCh38)
Location 9:15506705-15506727
Sequence CAAGAGCACAACATCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051286878_1051286880 -1 Left 1051286878 9:15506683-15506705 CCTCAACATTTATCTGAATAAAC 0: 1
1: 0
2: 2
3: 28
4: 300
Right 1051286880 9:15506705-15506727 CAAGAGCACAACATCCAAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051286880 Original CRISPR CAAGAGCACAACATCCAAAA GGG Intronic
900536739 1:3182371-3182393 CAGGAGCCCAACAGCCAACAGGG - Intronic
904429368 1:30451995-30452017 AAGGAGCTCAACATCCAAGAGGG + Intergenic
905697579 1:39986776-39986798 TAAGAGCAAAATATCCCAAAAGG + Intergenic
906130337 1:43451882-43451904 CAAGAGCACAGGAATCAAAAGGG + Exonic
906566638 1:46805751-46805773 CAAGAAAAAAACAACCAAAAGGG - Intronic
907507124 1:54927640-54927662 CCAGAGCACAACATGTTAAAAGG + Intergenic
910855441 1:91690377-91690399 CAAGAGTACCACATTCAAAAGGG + Intronic
911965489 1:104364117-104364139 CAACAACAAATCATCCAAAAAGG + Intergenic
912222417 1:107693561-107693583 AAGGAAGACAACATCCAAAAAGG + Intronic
912391691 1:109307274-109307296 CTTGAACACACCATCCAAAAGGG + Intergenic
913252264 1:116921693-116921715 CAAGATTACAAAGTCCAAAATGG + Intronic
915056593 1:153137899-153137921 CAAGAGAAAACCATCCAAATTGG + Intergenic
916158637 1:161886018-161886040 CAAGAGCACTACATTCATCAAGG + Intronic
917088856 1:171331675-171331697 CAAGAGTACAAGATCCCAGAAGG + Exonic
917514379 1:175695182-175695204 CAAGAGCAAGGGATCCAAAAAGG - Intronic
917654361 1:177111802-177111824 CAAAAGCCCACCATACAAAAGGG - Intronic
918023635 1:180720367-180720389 AAAAAGCAAAACTTCCAAAAAGG - Intronic
921516537 1:216099254-216099276 CAAGAACACAACATTCAAGCAGG - Intronic
923008846 1:230072555-230072577 CAAAAGCACAAAAACCAACAGGG - Intronic
923254150 1:232205483-232205505 GAAGGGCACAAAACCCAAAATGG - Intergenic
1063936621 10:11084950-11084972 TAATAGCAGAACATCCCAAAAGG - Intronic
1064148812 10:12846149-12846171 CAACAGCACAAAACCCAAGAAGG - Intergenic
1064200369 10:13279325-13279347 CAAGAGTAGAACACTCAAAAAGG - Intronic
1064460814 10:15533329-15533351 CATTAGAATAACATCCAAAAAGG - Intronic
1065864416 10:29901371-29901393 CAAAACCAAAACATCCAGAAGGG + Intergenic
1066079333 10:31914399-31914421 CAAGGGGCTAACATCCAAAAAGG + Intronic
1066538693 10:36420679-36420701 TAAGAGAAAAACATCCAGAAGGG - Intergenic
1067997445 10:51289950-51289972 AAAGAGAATACCATCCAAAAAGG - Intronic
1068125967 10:52842292-52842314 CAAGGGCACAGTAACCAAAACGG - Intergenic
1068547660 10:58367550-58367572 TATGAGCACAGTATCCAAAATGG + Intronic
1069624404 10:69858930-69858952 CAAGAGCCCCACCTGCAAAACGG + Intronic
1072447716 10:95514036-95514058 CAAGAACCCAATATTCAAAAGGG - Intronic
1072790516 10:98314399-98314421 CAATAGCACAATTTCCAACAGGG + Intergenic
1073877305 10:107940069-107940091 CAATAGCCCAACATGAAAAATGG - Intergenic
1077261686 11:1625285-1625307 CAGGAACACAGCCTCCAAAATGG + Intergenic
1078281307 11:9903829-9903851 CAGGGGCACACCACCCAAAAAGG - Intronic
1079137190 11:17782253-17782275 CAAGAGGAAAGCTTCCAAAAAGG + Exonic
1080080198 11:28207744-28207766 CAATAGCTTACCATCCAAAAAGG - Intronic
1080286455 11:30619799-30619821 CAATAGACTAACATCCAAAAAGG - Intergenic
1081177162 11:39943102-39943124 CAAGAGAATAACAGCCACAAAGG - Intergenic
1081779866 11:45702825-45702847 GAAGAGCAAACGATCCAAAAAGG + Intergenic
1083555289 11:63621303-63621325 CAACATGACAACATTCAAAATGG + Intergenic
1084839844 11:71837535-71837557 TGAGAGCACTACACCCAAAAAGG + Exonic
1085525282 11:77160318-77160340 CAAGAGCCCAACTTCCCAAGGGG - Intronic
1085961255 11:81465314-81465336 CAATAGCACTACATCTAAAAAGG - Intergenic
1086332484 11:85767922-85767944 CCAGAGCACAAAATACAAAGAGG + Intronic
1086562018 11:88178731-88178753 CAAGAGCACCACTGCCAAAGAGG + Intergenic
1091827876 12:3527599-3527621 CAATAGCACAAAGGCCAAAAGGG - Intronic
1093885810 12:24459059-24459081 CAAGAAGTCAACATCCAAATAGG + Intergenic
1094740563 12:33283489-33283511 CAGCAGCAAAACATCAAAAATGG + Intergenic
1096552100 12:52379657-52379679 CCAGAGCAAAACATTCATAAAGG - Intronic
1097315623 12:58167982-58168004 GAAGAGCATTACATTCAAAATGG + Intergenic
1099513990 12:83572744-83572766 CAAGATCACAGCAGCCAACATGG - Intergenic
1100149925 12:91724667-91724689 CAAGATCTCAACAGCCAAACTGG + Intergenic
1100283953 12:93146406-93146428 CAGGAGCACAAGAGCCCAAATGG - Intergenic
1106127016 13:26909004-26909026 CAAGAGCACCACAGCCAGAATGG + Intergenic
1107441113 13:40428173-40428195 CAAGAGCAGAACATAGCAAATGG - Intergenic
1107644703 13:42481851-42481873 TAAGAGCAGTACATCCAGAAAGG + Intergenic
1108034370 13:46273293-46273315 CCAGAACAAAACATCCATAAAGG + Intronic
1110363247 13:74652293-74652315 CAAGAGCAGGAATTCCAAAATGG + Intergenic
1110578811 13:77094166-77094188 AAAGAGGACAATTTCCAAAATGG + Intronic
1112814549 13:103256547-103256569 CAAGTGAACAAGTTCCAAAAAGG - Intergenic
1114396141 14:22363718-22363740 CATGAGCCTAACTTCCAAAATGG - Intergenic
1115316817 14:32033539-32033561 CAAGAGAACAACATGCATAAAGG - Intergenic
1117206015 14:53444347-53444369 GAAGAGCAGAACATTCAAAAGGG - Intergenic
1117702729 14:58430696-58430718 GAAGAGAACAACAAGCAAAAAGG + Exonic
1118490353 14:66253092-66253114 CATGGACACAACATCCAGAAGGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125378605 15:39061379-39061401 TAAGTGAACAACATGCAAAATGG - Intergenic
1126231490 15:46331785-46331807 CAATAATACAACAACCAAAATGG + Intergenic
1127363268 15:58263707-58263729 CAAAACCAAAACATCCCAAATGG + Intronic
1127924462 15:63525266-63525288 CATGAGCACCAAATCCAAAGTGG - Intronic
1127975818 15:63996696-63996718 GCAGAGCACGACTTCCAAAACGG + Intronic
1128721774 15:69955454-69955476 CATGTGCACATCATCCAACAAGG - Intergenic
1130784524 15:87081688-87081710 ACTGAGCAGAACATCCAAAATGG + Intergenic
1130864324 15:87919282-87919304 CAAGAGCCCAAAAACAAAAATGG + Intronic
1131830166 15:96349245-96349267 CAAAAGCAAAAGATACAAAATGG + Intergenic
1137308857 16:47233317-47233339 CAAGAGCAGAAGATCAAAGATGG + Intronic
1137554769 16:49463621-49463643 CAAAAGTACAAGATTCAAAAAGG + Intergenic
1138178012 16:54919883-54919905 AAAGGGCATAATATCCAAAAAGG + Intergenic
1140087333 16:71808819-71808841 CAGGAACCGAACATCCAAAATGG + Exonic
1142592028 17:1010462-1010484 CAAGAGGCCAACGTCCAAATAGG + Intronic
1143531085 17:7503787-7503809 GAAGAGCACAACACTCACAATGG - Exonic
1146438285 17:32871904-32871926 AATGAGCTCCACATCCAAAAAGG + Intronic
1147921920 17:43922791-43922813 CCAGAGCCCAACACCCACAATGG - Intergenic
1148173873 17:45547742-45547764 CCAGAGCCCAACACCCACAATGG - Intergenic
1148275395 17:46297705-46297727 CCAGAGCCCAACACCCACAATGG + Exonic
1148297500 17:46515284-46515306 CCAGAGCCCAACACCCACAATGG + Exonic
1148362050 17:47019763-47019785 CCAGAGCCCAACACCCACAATGG + Intronic
1150405086 17:64894664-64894686 CCAGAGCCCAACACCCACAATGG - Exonic
1156749215 18:40430192-40430214 CAAGGGCACAGTATTCAAAAAGG + Intergenic
1156859545 18:41819725-41819747 CAAGATCATAACATGCAAGATGG + Intergenic
1157339115 18:46763400-46763422 CAAGAGCAGAGGTTCCAAAAGGG - Intergenic
1157397457 18:47354849-47354871 CAAGAACAGAACATGCAAAAGGG + Intergenic
1157476538 18:48027647-48027669 CAAAAACACAACAAACAAAAAGG - Exonic
1159726778 18:71970635-71970657 AAAGAGCACAGCATGGAAAAGGG + Intergenic
1160154027 18:76419297-76419319 CAAGAGAAAAACATACTAAAGGG + Intronic
925099673 2:1234737-1234759 CAAGACCACAGCATCGATAAAGG + Intronic
925167303 2:1725148-1725170 CAACAGCAAATTATCCAAAAAGG - Intronic
925388200 2:3478096-3478118 CCAGAGCACAGGATCCAGAACGG - Intronic
926569973 2:14518970-14518992 CAAGTAACCAACATCCAAAAGGG + Intergenic
928031372 2:27782737-27782759 AAAGAGTACAACATGAAAAAAGG - Intronic
928731638 2:34238697-34238719 ATAGAGCCCTACATCCAAAAGGG - Intergenic
930292887 2:49518066-49518088 TAAGAACACAACATAAAAAATGG + Intergenic
931043109 2:58319513-58319535 CAAGACCACAAAATAAAAAAAGG + Intergenic
931676158 2:64698322-64698344 TAAGAGCACAGCCTACAAAATGG + Intronic
931808267 2:65829058-65829080 CAAGGGCAAAACATCAGAAAAGG - Intergenic
932984669 2:76710573-76710595 CAAGACTACAATAACCAAAACGG - Intergenic
934993911 2:98939786-98939808 CCAGAGCACAACCTCCAGGAGGG + Intergenic
935535247 2:104285895-104285917 AAAAAGCACAACATTCAAAGAGG + Intergenic
936813814 2:116434923-116434945 CAACAGCAAAACATAAAAAATGG + Intergenic
937102518 2:119282764-119282786 CAACAGCAGAACAACAAAAAGGG + Intergenic
937185926 2:120042583-120042605 CAAGAGAACAGCATACATAATGG + Intronic
937846860 2:126588158-126588180 CAACAGCACAACAGCCAGGAGGG + Intergenic
938324385 2:130388474-130388496 CAGGAGCACAGCATTCAAAAGGG + Intergenic
939402236 2:141709398-141709420 CCAGAGCACATTCTCCAAAAGGG - Intronic
940077475 2:149759167-149759189 CAAGAGCAAAACAGACAAACGGG - Intergenic
941363825 2:164585333-164585355 CAAGAGCAAAACAAGCTAAATGG + Intronic
941395838 2:164971655-164971677 CAATACCACTCCATCCAAAATGG - Intergenic
941499484 2:166252464-166252486 CAAGACCACAAAATCAAATACGG + Intronic
942080680 2:172396892-172396914 CAAGAGCACAGCATCTACAGGGG + Intergenic
945227522 2:207547266-207547288 CAAAATCACTACATCCAAATGGG - Intronic
945551820 2:211229648-211229670 GAAGAGCATACCATCCTAAAAGG + Intergenic
945866673 2:215183404-215183426 CAAGAGCAAAGCATCATAAAAGG + Intergenic
946026756 2:216676571-216676593 CAAGGGCTCAACTTCGAAAATGG - Exonic
946724963 2:222653222-222653244 GAAGAGCAAAATAACCAAAATGG + Intronic
1169621107 20:7507531-7507553 CAAAAGCACACCTTCTAAAAAGG + Intergenic
1173365893 20:42384446-42384468 TAAGGAAACAACATCCAAAATGG + Intronic
1174877149 20:54239488-54239510 CAAGAGCAAAACAATAAAAATGG + Intergenic
1178855581 21:36247511-36247533 CCACAGCACAACCTCCAAGAGGG + Exonic
1181446757 22:22982464-22982486 CAAGAGAGAGACATCCAAAAAGG - Intergenic
1181597407 22:23925350-23925372 CAAGAGCACACCAAACAAAGGGG - Intergenic
1182683789 22:32104846-32104868 GAAGAGGAGAACATCCAAGAAGG + Exonic
1183197991 22:36366622-36366644 CAAGAGCACAAGAACGAAAGAGG + Intronic
1185203378 22:49522254-49522276 GAAGAGCAGAACATCCTGAATGG - Intronic
949092499 3:45528-45550 CACCACCACATCATCCAAAATGG + Intergenic
949405208 3:3706678-3706700 CAATATCCCAATATCCAAAATGG + Intronic
950431163 3:12952050-12952072 CAGGAGCACCATATCTAAAACGG + Intronic
951016817 3:17741471-17741493 CAAGAGCACAACACTTATAAAGG + Intronic
951327773 3:21325553-21325575 CAAGAACACAACATTAAATATGG + Intergenic
951406275 3:22302697-22302719 CAAGAATACAATATCTAAAATGG - Intronic
951471647 3:23062822-23062844 CCAGAGCACAACATTTAAGAAGG - Intergenic
952610456 3:35202725-35202747 CAAGAGCAAAAGATACATAAAGG - Intergenic
952889998 3:38033487-38033509 CAAGAGCACCCCAGCCAACATGG - Intergenic
953170488 3:40502407-40502429 CAAAAACACAACATCCCAAGTGG - Intergenic
953831786 3:46303803-46303825 AAAGGGCACAACAGCCACAATGG - Intergenic
956269472 3:67434838-67434860 CAAGAGAACTGCACCCAAAAGGG + Intronic
956497213 3:69840659-69840681 CAACAGGACAAAATCCAAAGAGG - Intronic
962412892 3:135156762-135156784 TAAGAGCCCTAAATCCAAAATGG - Intronic
962554195 3:136529295-136529317 CAAGAGGCTAAGATCCAAAAAGG + Intronic
964277611 3:155024727-155024749 TAAGAGCATAACATAGAAAAAGG + Intronic
964832028 3:160894743-160894765 AAAGAGTACACCAACCAAAATGG - Intronic
965549705 3:169951760-169951782 CAAGGGGATAACAACCAAAAAGG - Intergenic
966998062 3:185304000-185304022 CAAAAGCACAACATACCAAAAGG - Intronic
969780928 4:9403538-9403560 TGAGAGCACTACACCCAAAAAGG + Intergenic
971772971 4:30923116-30923138 AACTAGCACAGCATCCAAAATGG - Intronic
972234606 4:37116451-37116473 CAAAGGCACAATATTCAAAATGG - Intergenic
976396174 4:84557987-84558009 AAAGAGCAGAACCTACAAAAAGG + Intergenic
976432084 4:84974099-84974121 CAAAAGCACAACAGCAAAAAAGG - Intergenic
976999826 4:91483249-91483271 CTAGAGAAAAACAGCCAAAAGGG + Intronic
977177299 4:93833053-93833075 CAAGAGAAAAACAACCATAACGG + Intergenic
977886997 4:102263405-102263427 CAATAGCATAATATCTAAAAAGG + Intronic
978426675 4:108590410-108590432 CCAGAGCACAAGTTCCAAGAAGG + Intergenic
978673683 4:111283000-111283022 CATGAGCACAACACCTAAATAGG + Intergenic
981254543 4:142646082-142646104 CAAGGGTCCATCATCCAAAAAGG - Intronic
985216627 4:187660314-187660336 GAAGAGCAGGACATCCAAGATGG - Intergenic
985638049 5:1049574-1049596 CAAGTTCACAGCAGCCAAAATGG - Intergenic
985804032 5:2026943-2026965 CAAGAGAATAACATTTAAAAAGG - Intergenic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
986192400 5:5509571-5509593 GAAGAGAACCACATCCAGAATGG + Intergenic
986861280 5:11929128-11929150 CAAGAGCACACAAGCCAAACAGG + Intergenic
987942342 5:24555988-24556010 CATAAGCAAAACATCCAATAAGG - Intronic
989216145 5:38907062-38907084 CAAGAGAAACACATCCCAAAAGG + Intronic
991511190 5:67377985-67378007 CATCAGCACAAAAGCCAAAAAGG - Intergenic
993230596 5:85230565-85230587 CAACAACACAACCTCCAGAATGG - Intergenic
993630978 5:90285687-90285709 AGAGAGCACAGCATCCACAAAGG + Intergenic
994143915 5:96371636-96371658 CAAGAACCCAACACCCAGAATGG - Intergenic
995511146 5:112910547-112910569 CCAGATCAAAACAACCAAAATGG - Intronic
996282074 5:121742115-121742137 CAAGGGCACAAACACCAAAAAGG + Intergenic
996409965 5:123147606-123147628 AAAGAGTACAACATCAAAGAGGG + Intronic
996650040 5:125864802-125864824 CAAGAGCTAAACATTCAAATCGG + Intergenic
996838951 5:127825204-127825226 TAAAAGCACATCATCCACAATGG + Intergenic
997085811 5:130797078-130797100 CATGAGCACTCCATCCAGAAAGG - Intergenic
999099699 5:149013126-149013148 CAATAGCATAACACCAAAAAAGG - Intronic
999929948 5:156420831-156420853 CAGAATCATAACATCCAAAATGG - Intronic
1000179795 5:158797428-158797450 CAAGAAAGCAACATCCTAAAGGG + Intronic
1005173544 6:23016562-23016584 CTAGAGCACTAGATGCAAAATGG + Intergenic
1007391320 6:41551126-41551148 CAAGACCACAGCATCCAAAGTGG - Intronic
1007677754 6:43611853-43611875 CAAGAGCACCCCAGCCAACATGG + Intronic
1008216742 6:48799446-48799468 CAATAGCAAAACAACCACAATGG - Intergenic
1011979545 6:93356068-93356090 CATGAGCATAACAAACAAAAAGG + Intronic
1015346355 6:132164097-132164119 GAAGAGGGCAACTTCCAAAAAGG - Intergenic
1016983989 6:149880657-149880679 CTCGAGCTCAACATTCAAAAGGG - Intergenic
1017880023 6:158555850-158555872 CAAGAGAAAAACATTCTAAACGG - Intronic
1018984301 6:168624106-168624128 CACCACCACAACATTCAAAATGG + Intronic
1022531413 7:31069145-31069167 CCAGAGCACAGCATCCACCAGGG + Intronic
1023166870 7:37351519-37351541 CAAGAGGAAAACATTCAAAAGGG + Intronic
1023247046 7:38216114-38216136 CAGGAATACAACATCCCAAAGGG - Intronic
1023547501 7:41333998-41334020 CAAGGGAGCAACATCAAAAAAGG + Intergenic
1026590505 7:71690790-71690812 CAAGAGAACTAGAACCAAAATGG + Intronic
1028295642 7:89127344-89127366 GAAGAGCACAAATCCCAAAACGG + Intronic
1028444781 7:90909156-90909178 AAATAGCACAAAATCCAAATTGG - Intronic
1031920642 7:127598272-127598294 CCACAGCACATCTTCCAAAAAGG + Intronic
1033403870 7:141053256-141053278 CAAAAGCACAAAATCTATAAAGG - Intergenic
1034013761 7:147559301-147559323 CCAGAGCACAACATTCACATTGG + Intronic
1036278365 8:7377473-7377495 TGAGAGCACTACACCCAAAAAGG + Intronic
1036343158 8:7934417-7934439 TGAGAGCACTACACCCAAAAAGG - Intronic
1036764121 8:11535883-11535905 CAAGGACGCAAAATCCAAAATGG + Intronic
1037660197 8:20919742-20919764 TACGAGCCCAAAATCCAAAAGGG + Intergenic
1037669217 8:20999976-20999998 AAAGAACACAACATCCTAGAGGG + Intergenic
1038298052 8:26314711-26314733 CCAAAGCACATCATCCAGAAAGG - Intronic
1040995763 8:53400601-53400623 CAAGAAGACAAAATACAAAATGG - Intergenic
1042499643 8:69494331-69494353 TGATAGTACAACATCCAAAATGG + Intronic
1043085703 8:75828473-75828495 CAATAGCACAGAAACCAAAAAGG + Intergenic
1044381458 8:91538975-91538997 CAAGAACACAAGATGGAAAAAGG - Intergenic
1044756425 8:95466972-95466994 CAAAATCAGGACATCCAAAATGG - Intergenic
1046389705 8:113554236-113554258 TAAGAGCTCTAAATCCAAAATGG - Intergenic
1046724267 8:117657235-117657257 AATAAGAACAACATCCAAAACGG + Intergenic
1046799812 8:118413513-118413535 CTAGAGCACTGCATCCACAATGG + Intronic
1048649223 8:136455731-136455753 AAACAGCACAACCTCCAAAAGGG + Intergenic
1050516773 9:6452763-6452785 CAAATGCAAAGCATCCAAAATGG - Intronic
1050971077 9:11875225-11875247 CAAGATCAGAACATACAGAAAGG + Intergenic
1051286880 9:15506705-15506727 CAAGAGCACAACATCCAAAAGGG + Intronic
1051441088 9:17083967-17083989 CAGCAGCAAAACATGCAAAAGGG - Intergenic
1051961664 9:22772405-22772427 CAAGAGCATAGTATGCAAAAAGG - Intergenic
1052243558 9:26305572-26305594 AAAGAGCACAACATCAAACAAGG + Intergenic
1055988713 9:82081951-82081973 CAAGAGCAAATCATAGAAAAAGG - Intergenic
1057439399 9:95072085-95072107 CCAGAGCACAACATACACAGTGG - Intronic
1059886676 9:118751885-118751907 GAAGAGCTCACCATCCTAAAGGG + Intergenic
1060380268 9:123163526-123163548 GAAAAGCAAAAGATCCAAAATGG + Intronic
1060500916 9:124154390-124154412 CAAGAACACAATAACAAAAAAGG + Intergenic
1061459263 9:130723204-130723226 CAGGGGCACAACTACCAAAAAGG - Intronic
1062628907 9:137454925-137454947 CCAAGGCCCAACATCCAAAACGG + Intronic
1186448582 X:9653311-9653333 CAAGAGCAAACCAGCCCAAAGGG - Intronic
1187702515 X:21976628-21976650 CAAGAGCAGAACATCTATAAAGG + Intronic
1188172808 X:26949009-26949031 CAAGAGCAAAACAACCCCAAAGG - Intergenic
1189790227 X:44596805-44596827 CAATAGCACAAAAGCCTAAAGGG + Intergenic
1192230733 X:69263200-69263222 CAAGAGCTCACCGTCCAAAGAGG + Intergenic
1195839671 X:109159761-109159783 CCAGAGAACAACAAACAAAATGG + Intergenic
1202023708 Y:20496183-20496205 CAAGAGCAGCCCAGCCAAAATGG + Intergenic
1202302888 Y:23436391-23436413 CAAGAGAAAAACCTCCTAAATGG + Intergenic
1202567923 Y:26234203-26234225 CAAGAGAAAAACCTCCTAAATGG - Intergenic