ID: 1051286951

View in Genome Browser
Species Human (GRCh38)
Location 9:15507404-15507426
Sequence CTCTGGGAGGGCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051286941_1051286951 11 Left 1051286941 9:15507370-15507392 CCAGGCGCGGTGGCTCACACCTG 0: 5188
1: 48533
2: 104821
3: 143032
4: 163685
Right 1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG No data
1051286944_1051286951 -8 Left 1051286944 9:15507389-15507411 CCTGTAATCCCAGCACTCTGGGA 0: 7643
1: 296201
2: 259723
3: 149283
4: 132738
Right 1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051286951 Original CRISPR CTCTGGGAGGGCAAGGTGGA TGG Intronic
No off target data available for this crispr