ID: 1051292597

View in Genome Browser
Species Human (GRCh38)
Location 9:15560254-15560276
Sequence GCAGGCCAACATTCAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12453
Summary {0: 2540, 1: 4160, 2: 3571, 3: 1384, 4: 798}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051292597_1051292604 4 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292604 9:15560281-15560303 CTAGGTTGGGGAAGCTCTCCTGG 0: 22
1: 2263
2: 5793
3: 2342
4: 924
1051292597_1051292599 -10 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292599 9:15560267-15560289 GTTGGCCTGCCTCACTAGGTTGG 0: 33
1: 76
2: 1503
3: 5782
4: 2809
1051292597_1051292601 -8 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292601 9:15560269-15560291 TGGCCTGCCTCACTAGGTTGGGG 0: 34
1: 80
2: 1540
3: 6003
4: 2680
1051292597_1051292606 20 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292606 9:15560297-15560319 CTCCTGGATGATATCCTGAAGGG No data
1051292597_1051292600 -9 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292600 9:15560268-15560290 TTGGCCTGCCTCACTAGGTTGGG 0: 34
1: 77
2: 1615
3: 6039
4: 2669
1051292597_1051292605 19 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051292597 Original CRISPR GCAGGCCAACATTCAAATTC AGG (reversed) Intronic
Too many off-targets to display for this crispr