ID: 1051292602

View in Genome Browser
Species Human (GRCh38)
Location 9:15560272-15560294
Sequence CTTCCCCAACCTAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051292602_1051292606 2 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG No data
Right 1051292606 9:15560297-15560319 CTCCTGGATGATATCCTGAAGGG No data
1051292602_1051292608 15 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG No data
Right 1051292608 9:15560310-15560332 TCCTGAAGGGTGTTTTCCACTGG No data
1051292602_1051292610 16 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG No data
Right 1051292610 9:15560311-15560333 CCTGAAGGGTGTTTTCCACTGGG No data
1051292602_1051292605 1 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG No data
Right 1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051292602 Original CRISPR CTTCCCCAACCTAGTGAGGC AGG (reversed) Intronic