ID: 1051292605

View in Genome Browser
Species Human (GRCh38)
Location 9:15560296-15560318
Sequence TCTCCTGGATGATATCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051292602_1051292605 1 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG 0: 29
1: 75
2: 1435
3: 5801
4: 2779
Right 1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG No data
1051292603_1051292605 -3 Left 1051292603 9:15560276-15560298 CCTCACTAGGTTGGGGAAGCTCT 0: 1
1: 30
2: 97
3: 1551
4: 5039
Right 1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG No data
1051292597_1051292605 19 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC 0: 2540
1: 4160
2: 3571
3: 1384
4: 798
Right 1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051292605 Original CRISPR TCTCCTGGATGATATCCTGA AGG Intronic
No off target data available for this crispr