ID: 1051292606

View in Genome Browser
Species Human (GRCh38)
Location 9:15560297-15560319
Sequence CTCCTGGATGATATCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051292602_1051292606 2 Left 1051292602 9:15560272-15560294 CCTGCCTCACTAGGTTGGGGAAG No data
Right 1051292606 9:15560297-15560319 CTCCTGGATGATATCCTGAAGGG No data
1051292603_1051292606 -2 Left 1051292603 9:15560276-15560298 CCTCACTAGGTTGGGGAAGCTCT No data
Right 1051292606 9:15560297-15560319 CTCCTGGATGATATCCTGAAGGG No data
1051292597_1051292606 20 Left 1051292597 9:15560254-15560276 CCTGAATTTGAATGTTGGCCTGC No data
Right 1051292606 9:15560297-15560319 CTCCTGGATGATATCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051292606 Original CRISPR CTCCTGGATGATATCCTGAA GGG Intronic