ID: 1051292606 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:15560297-15560319 |
| Sequence | CTCCTGGATGATATCCTGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051292602_1051292606 | 2 | Left | 1051292602 | 9:15560272-15560294 | CCTGCCTCACTAGGTTGGGGAAG | No data | ||
| Right | 1051292606 | 9:15560297-15560319 | CTCCTGGATGATATCCTGAAGGG | No data | ||||
| 1051292603_1051292606 | -2 | Left | 1051292603 | 9:15560276-15560298 | CCTCACTAGGTTGGGGAAGCTCT | No data | ||
| Right | 1051292606 | 9:15560297-15560319 | CTCCTGGATGATATCCTGAAGGG | No data | ||||
| 1051292597_1051292606 | 20 | Left | 1051292597 | 9:15560254-15560276 | CCTGAATTTGAATGTTGGCCTGC | No data | ||
| Right | 1051292606 | 9:15560297-15560319 | CTCCTGGATGATATCCTGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051292606 | Original CRISPR | CTCCTGGATGATATCCTGAA GGG | Intronic | ||