ID: 1051297587

View in Genome Browser
Species Human (GRCh38)
Location 9:15612996-15613018
Sequence ACCCCCAACAAAACAGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051297587_1051297588 23 Left 1051297587 9:15612996-15613018 CCATAGACTGTTTTGTTGGGGGT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1051297588 9:15613042-15613064 ACATAGATTTTCTGTTCTCTTGG No data
1051297587_1051297589 24 Left 1051297587 9:15612996-15613018 CCATAGACTGTTTTGTTGGGGGT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1051297589 9:15613043-15613065 CATAGATTTTCTGTTCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051297587 Original CRISPR ACCCCCAACAAAACAGTCTA TGG (reversed) Intronic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
911092336 1:94027730-94027752 AAACCCAACAAAAAAGGCTATGG - Intronic
912851715 1:113131608-113131630 ACTCCAAACAAAAAAGTTTAAGG - Exonic
919833126 1:201555930-201555952 AACCCCAAGAGAACAGTCTGTGG + Intergenic
919916172 1:202140808-202140830 ATCCCCAACAATAGAGTCTGAGG + Intronic
922220604 1:223555687-223555709 ACTAACAACAAAACAGTATATGG + Intronic
922826766 1:228526830-228526852 ACCCCCCTCAAAACTGTCAAGGG + Intergenic
923241367 1:232088675-232088697 ACCCCCAACAAAATGGTGAATGG + Intergenic
1066358450 10:34707431-34707453 ACCACCAAAAAAAAAGTCTCTGG + Intronic
1075785476 10:125046611-125046633 ACTCCCACCAAAACATTCTTAGG + Intronic
1077532263 11:3102952-3102974 CCCCCCAAGAAAACAGCCTCAGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080269187 11:30432999-30433021 ACCCCCATCAGAACAGTGCAAGG - Intronic
1081377246 11:42374520-42374542 ACCTCCAGCAAAACAGGCTTGGG - Intergenic
1090388556 11:126372017-126372039 ACCACCACCAAAACAATCAAAGG - Intronic
1091375656 12:23173-23195 ATCCCCAACAAAAAAGCCCACGG + Intergenic
1093182121 12:15978677-15978699 GCCCCTAAAAAAACAGTCTGGGG - Intronic
1095461340 12:42447442-42447464 ACCCCTTACCAAGCAGTCTATGG + Intronic
1096895671 12:54818940-54818962 ACCACCAGCACAACAGTCTGAGG - Intergenic
1101797815 12:107992118-107992140 ACCCCCAGGACAACAGCCTATGG + Intergenic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG + Intronic
1108407869 13:50123646-50123668 ACACCCAAAAAGACACTCTACGG + Intronic
1111290531 13:86162792-86162814 AACAACAACAAAACAGTCTATGG + Intergenic
1111539714 13:89654846-89654868 ACCTCCAAAAAATCTGTCTATGG - Intergenic
1112603267 13:100878184-100878206 TACCCAAAGAAAACAGTCTATGG + Intergenic
1113286655 13:108857083-108857105 ACAAACAAAAAAACAGTCTAAGG - Intronic
1115808446 14:37078898-37078920 AACCACAACAGAACAGACTATGG + Intronic
1116700501 14:48235623-48235645 AACCACAACACAACAGTCTCAGG + Intergenic
1117971096 14:61251809-61251831 ATTCCCAACAAAACTGTATAAGG + Intronic
1125414055 15:39434268-39434290 AACCCAAACACAACAGTCTTAGG + Intergenic
1126701637 15:51373051-51373073 ATCCCCAACATAACAGTGTTGGG - Intronic
1131747931 15:95470033-95470055 AACCCCAACAAAACACTATAAGG + Intergenic
1132182234 15:99765546-99765568 ACTCCGAAGAAAACAGTCTGGGG - Intergenic
1134171576 16:11973833-11973855 AACCCCAGCAAAACAGGTTATGG + Intronic
1135581542 16:23631494-23631516 AAACCAAACAAAACAGTGTATGG + Intronic
1136347762 16:29687195-29687217 TCCCCCATCATCACAGTCTACGG + Intronic
1138849778 16:60613466-60613488 ACCCCCAATACAACAGTATTGGG - Intergenic
1144679865 17:17186023-17186045 AACCACCACAAAACATTCTATGG + Exonic
1145372935 17:22322477-22322499 ATCCCCAACCACACAGTCAACGG - Intergenic
1148562504 17:48613999-48614021 ACCCCCCATAAAACAGTAAAAGG + Intronic
1149516167 17:57282607-57282629 ACCCCTAACAAAACAGAACAGGG - Intronic
1150610661 17:66730710-66730732 ACCCCTAATACAACAGTCTGTGG - Intronic
1151048113 17:70945623-70945645 ACCCACAAAAAAACATTCAATGG + Intergenic
1152049492 17:77960762-77960784 TCCCCCAACAAAGCATCCTAGGG - Intergenic
1159906883 18:74100923-74100945 ACCACCAACAAAAAAGTCCAGGG + Intronic
1161832982 19:6623353-6623375 ATCAAAAACAAAACAGTCTATGG + Intergenic
1164384729 19:27763011-27763033 AGCCCAAGCAAGACAGTCTAAGG - Intergenic
1164415235 19:28041593-28041615 ATCCCCAACACAACAGTGTCAGG + Intergenic
925644288 2:6020418-6020440 ATAACCAACAAAAAAGTCTAAGG - Intergenic
928083374 2:28329238-28329260 TCCCCCGACAAAACTGTCTATGG + Intronic
930630315 2:53746457-53746479 ACCCCCCAAAAAACAGTGTGTGG - Intronic
931726283 2:65114537-65114559 ATCCCCAATACAACAGTTTAAGG + Intronic
932516544 2:72356576-72356598 ACCCCAAAGTAAACAGTATAAGG + Intronic
946601123 2:221361453-221361475 ACCCCCCACAGAAAAGTCAATGG - Intergenic
1170501395 20:16978131-16978153 ACCCCCAAGAAAACAGATTGAGG + Intergenic
1172547539 20:35773029-35773051 AACCCCAATAATACAGTCTCGGG - Intronic
1174288213 20:49487088-49487110 AACCCAAACAAAACAATATACGG - Intergenic
1174887612 20:54352809-54352831 ACCCCCAACATGACAGTATTTGG - Intergenic
1175617806 20:60416964-60416986 ACTACCAACAAAAAAGTCCAAGG - Intergenic
1179139196 21:38709284-38709306 AACCCCAAAAAACCTGTCTATGG - Intergenic
1179267323 21:39815473-39815495 ACCCCAAATAAAAAACTCTAAGG + Intergenic
1182351062 22:29700218-29700240 ACCCCCACCAAAATAGTAAATGG + Intergenic
949997381 3:9628992-9629014 ACCCCCAAAAAAACAGCATTTGG - Intergenic
950466509 3:13158545-13158567 TCCCCAAACAAAACAGTCCTTGG + Intergenic
952644178 3:35636390-35636412 GTTTCCAACAAAACAGTCTAGGG - Intergenic
953225138 3:41011779-41011801 ACCCCCAAAAGCACAGTCTGGGG + Intergenic
953521966 3:43651858-43651880 TCCTCCTACAATACAGTCTAGGG + Intronic
954847430 3:53572018-53572040 ACCTCAAACAAATCAGTCCATGG - Intronic
959333319 3:105034301-105034323 ACAAACAAAAAAACAGTCTATGG + Intergenic
960764519 3:121111483-121111505 ACCCCCAACAAACCAGAAGAGGG - Intronic
962528482 3:136256803-136256825 ATCCCCCCCAAAACAGACTAAGG - Intronic
963761197 3:149288694-149288716 ACCCCCACCCCAACAGTCTCAGG + Intergenic
964166701 3:153715600-153715622 ACACCCAACAAAGCAGTCATGGG - Intergenic
968149097 3:196323000-196323022 ACCCCCAATATGACAGTCTTTGG - Intronic
969249586 4:5958199-5958221 CCCCCCAAAAAGAGAGTCTAGGG - Exonic
972802526 4:42492118-42492140 ACCCCAAACAAAAAAGTAAAAGG + Intronic
973225847 4:47783479-47783501 ACCCCCAAGAAAAATGTCTTAGG + Intronic
973307919 4:48674358-48674380 ACATACAAAAAAACAGTCTAAGG + Intronic
975028491 4:69582700-69582722 ACTCCCACCAAAGCACTCTATGG - Intergenic
978535244 4:109755448-109755470 ATCCCCAACACAACAGTGTTGGG + Intronic
984229568 4:177078491-177078513 ACTCCTAACCAAGCAGTCTATGG - Intergenic
984632170 4:182072869-182072891 ACCCCCAACATGACAGTATTTGG + Intergenic
986148772 5:5107447-5107469 ATCCCCAACACAACAGTGTTGGG + Intergenic
986448781 5:7846600-7846622 ACCCCCAACATGACAGTATTAGG - Intronic
988823837 5:34915273-34915295 GCCTCCAACAAAACAGGCGATGG + Intronic
989282532 5:39661811-39661833 AACAACAACAAAACTGTCTATGG + Intergenic
1005752926 6:28900088-28900110 ACCTCAAACAAAACAGTCAAGGG - Intergenic
1007449074 6:41929604-41929626 ACACCCAACAATACTGTTTAAGG + Intronic
1011665886 6:89633023-89633045 ACTCCCACCAAAGCACTCTATGG - Exonic
1013018783 6:106188822-106188844 TCCCTCAACAGAACAGTTTAAGG + Intronic
1022257827 7:28676952-28676974 ACACCCATCTGAACAGTCTATGG - Intronic
1024732913 7:52273094-52273116 ACCCCCAATAAACTTGTCTATGG - Intergenic
1028339369 7:89699425-89699447 GCCCCCAAAAAAACTGGCTATGG + Intergenic
1028857412 7:95607344-95607366 ACCCCCAAAAAATTAGTCTAAGG - Intergenic
1031186674 7:118490002-118490024 ACCAACAGCAAAACAGACTAAGG - Intergenic
1031485839 7:122322662-122322684 TCCCCCAAAAAATCATTCTAAGG + Intronic
1033973092 7:147067377-147067399 ACCCCCAATAAAACAGCATTTGG - Intronic
1035386372 7:158475528-158475550 ACCCCCAGCAAAACACCCTCGGG + Intronic
1035393433 7:158520619-158520641 ACCACCCACAAAACAGTGGAAGG - Intronic
1035653423 8:1286478-1286500 ACAAACAAGAAAACAGTCTACGG - Intergenic
1039043376 8:33428645-33428667 ATCCCCAACACAACAGTGTTGGG + Intronic
1040727751 8:50403228-50403250 ACCACCAACTAAACACTCCAAGG - Intronic
1042517846 8:69678295-69678317 ACCCCCAATAAACCTGTTTATGG - Intronic
1043496919 8:80811782-80811804 ACCCCCAACCCAAGAGTCTATGG + Intronic
1044782212 8:95754793-95754815 ACCCCCAACAAAACGTTGGAAGG + Intergenic
1047642303 8:126833632-126833654 ACTCCCAGCAAATCAGCCTAGGG - Intergenic
1050433832 9:5588707-5588729 ACCCCAAGGAAAACAGTCTCAGG - Intergenic
1051297587 9:15612996-15613018 ACCCCCAACAAAACAGTCTATGG - Intronic
1053459680 9:38258573-38258595 ATCCCCAACACAACAGTATTGGG - Intergenic
1203658343 Un_KI270753v1:19877-19899 ACCCCCAATAAAACATTTTTTGG - Intergenic
1187080550 X:15982090-15982112 AACCCTATCAAAACAGGCTAAGG - Intergenic
1187251725 X:17604926-17604948 AACCCCAATAAAACATTCAAGGG + Intronic
1187376036 X:18755572-18755594 GCCCCCAAAAAAAGAGTGTATGG + Intronic
1188013921 X:25086802-25086824 GCTCCCAGCAAAAGAGTCTAAGG - Intergenic
1190211074 X:48448443-48448465 AACCCGAAGAAAACAGTCCAAGG - Intergenic
1192917759 X:75672224-75672246 ACTCCCACCAAAGCACTCTATGG - Intergenic
1193151422 X:78128552-78128574 AAACCCCACAAAACAGTATAAGG + Exonic
1193258855 X:79381060-79381082 ACCCTCAAAAAAACATTCAAAGG + Intergenic
1193845220 X:86461382-86461404 CCCCCCAATACAACAGTCTGTGG - Intronic
1193901414 X:87182742-87182764 AACCCCTGCAAAAAAGTCTAAGG - Intergenic
1196903350 X:120408666-120408688 ACCCATAATAAAACAGTCTTAGG - Intergenic
1199623410 X:149718855-149718877 ACCTCCTACATAACAGTTTATGG + Intergenic