ID: 1051305162

View in Genome Browser
Species Human (GRCh38)
Location 9:15700524-15700546
Sequence TGCCTGGGCTCGAACCTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1167
Summary {0: 1, 1: 0, 2: 11, 3: 799, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051305162_1051305169 3 Left 1051305162 9:15700524-15700546 CCGCCAAGGTTCGAGCCCAGGCA 0: 1
1: 0
2: 11
3: 799
4: 356
Right 1051305169 9:15700550-15700572 GAGGCGCCGAGAGCAAGCGAGGG 0: 50
1: 398
2: 704
3: 657
4: 532
1051305162_1051305171 11 Left 1051305162 9:15700524-15700546 CCGCCAAGGTTCGAGCCCAGGCA 0: 1
1: 0
2: 11
3: 799
4: 356
Right 1051305171 9:15700558-15700580 GAGAGCAAGCGAGGGCTGTGAGG 0: 44
1: 479
2: 535
3: 368
4: 512
1051305162_1051305168 2 Left 1051305162 9:15700524-15700546 CCGCCAAGGTTCGAGCCCAGGCA 0: 1
1: 0
2: 11
3: 799
4: 356
Right 1051305168 9:15700549-15700571 GGAGGCGCCGAGAGCAAGCGAGG 0: 48
1: 377
2: 704
3: 667
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051305162 Original CRISPR TGCCTGGGCTCGAACCTTGG CGG (reversed) Intronic
900113344 1:1018795-1018817 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
900378879 1:2373882-2373904 TGCCTGGGCTGAGACCTTGCAGG + Intronic
901046044 1:6396212-6396234 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
901601545 1:10426843-10426865 TGCCTGGGCTCCTACTTTGGTGG - Intergenic
901629947 1:10643128-10643150 TGGCTGGGCTCTCACCTGGGGGG + Intronic
901834711 1:11916621-11916643 TGCCTGGCCTCGTAGCATGGTGG + Intergenic
902033374 1:13439161-13439183 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
902917793 1:19648963-19648985 TGCCTGGACTGGAAGCTTGGGGG - Intronic
904238948 1:29131561-29131583 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
904364742 1:30003062-30003084 TGCCTATGCTCCACCCTTGGAGG + Intergenic
905375557 1:37518128-37518150 CGCCTGGGCTCCCACTTTGGTGG + Intergenic
905827500 1:41037200-41037222 TGCCTGGCCTTGCACCTGGGAGG - Intronic
905858646 1:41331344-41331366 GGCCTGGGACCGAAGCTTGGAGG + Intergenic
906307426 1:44728574-44728596 TCACTGGGCTCAAACCTTGGAGG + Intergenic
907889420 1:58623308-58623330 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
907979989 1:59472008-59472030 TGCCTGGGCTCCCACTTTGGCGG + Intronic
908027823 1:59970148-59970170 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
908291263 1:62669766-62669788 TGCCTGGGCTCCCACTTTGGTGG + Intronic
908888522 1:68817596-68817618 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
909377145 1:74952531-74952553 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
910034839 1:82777266-82777288 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
910609823 1:89128528-89128550 TGCCTGGGCTCCCACTTTGGCGG - Intronic
910685772 1:89914442-89914464 TGCCTGGGCTCCCACTTTGGTGG - Intronic
910693204 1:89985101-89985123 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
911205863 1:95091267-95091289 TGCCTGGGCTCCTACTTTGGCGG + Intergenic
911259672 1:95670111-95670133 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
911305301 1:96224823-96224845 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
911839322 1:102660496-102660518 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
912058198 1:105631719-105631741 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
912166077 1:107044631-107044653 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
912312953 1:108641345-108641367 TGCCTGGGCTCTCACTTTGGTGG - Intronic
912315860 1:108667353-108667375 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
912819444 1:112854998-112855020 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
913161134 1:116147039-116147061 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
913468942 1:119171424-119171446 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
913692187 1:121289589-121289611 TGCCTGGGCTCCCACTTTGGTGG - Intronic
914145368 1:144990525-144990547 TGCCTGGGCTCCCACTTTGGTGG + Intronic
914203501 1:145506336-145506358 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
914482623 1:148079490-148079512 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
914927996 1:151906013-151906035 TGCCTGGGCTCCCACTTTGGCGG + Intronic
915104056 1:153521663-153521685 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
915261153 1:154677914-154677936 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
915666182 1:157446764-157446786 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
916219795 1:162433032-162433054 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
916910178 1:169337561-169337583 TGCATGGGCTCCCACTTTGGCGG - Intronic
916938971 1:169661093-169661115 TACCTGGGCTCCCACTTTGGCGG + Intergenic
917348936 1:174056850-174056872 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
917406289 1:174711321-174711343 TGCCTGGGCTCCCACTTTGGCGG - Intronic
917578618 1:176349754-176349776 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
917860446 1:179138716-179138738 TGCCTGGGCTCCCACTTTGGTGG + Intronic
917933068 1:179837414-179837436 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
918058931 1:181045711-181045733 TGCCTGGGCTCCCACTTTGGCGG + Intronic
918512076 1:185322165-185322187 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
918659829 1:187074300-187074322 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
918720767 1:187850084-187850106 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
918732367 1:188013783-188013805 TGCCTGGGCTCCCACTTTAGAGG - Intergenic
918792111 1:188841658-188841680 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
918853279 1:189718781-189718803 TGCCTGGGCTCCCATTTTGGCGG - Intergenic
918951940 1:191151305-191151327 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
918993821 1:191731691-191731713 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
919091830 1:192986788-192986810 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
919118001 1:193305178-193305200 TGCCTGGTCTCCCACTTTGGCGG - Intergenic
919168028 1:193919398-193919420 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
919174400 1:194001718-194001740 TGCCTGGGCTCCCAATTTGGCGG + Intergenic
919201422 1:194358753-194358775 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
919236968 1:194858943-194858965 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
919297836 1:195723372-195723394 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
920065343 1:203265724-203265746 TTCCTGGGCTCAAACCTCCGAGG + Intronic
920175561 1:204099380-204099402 TGCCTGGGCTCAAATCATGTTGG + Intronic
920188545 1:204177721-204177743 TTGCTGGGCTTGAACCTGGGTGG + Intergenic
920731441 1:208488922-208488944 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
920756612 1:208739557-208739579 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
920883222 1:209899285-209899307 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
921396458 1:214673630-214673652 TGCCTGGACTCCCACTTTGGCGG - Intergenic
921897027 1:220412308-220412330 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
921903917 1:220476178-220476200 TGCCTGAGCTCCCACTTTGGCGG - Intergenic
921983752 1:221286138-221286160 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
922056760 1:222049624-222049646 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
922423140 1:225472583-225472605 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
922485354 1:225969646-225969668 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
922541983 1:226426774-226426796 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
922855721 1:228773582-228773604 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
922985806 1:229865335-229865357 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
923157304 1:231289959-231289981 TGCCTGGGTTCCCACTTTGGCGG - Intergenic
923193520 1:231642389-231642411 TGCCTGGGCTCCCACTTTGGCGG - Intronic
923573740 1:235140163-235140185 TGCCTGGGCTCCCACTTTGACGG + Intronic
923930149 1:238685114-238685136 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
924117446 1:240762367-240762389 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
924219306 1:241856058-241856080 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1062782721 10:230508-230530 TGTCTGGGGTAGAACCCTGGAGG - Intronic
1063300464 10:4845399-4845421 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1063309365 10:4937864-4937886 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1063318804 10:5033001-5033023 TGCCTGGGCTCCCACTTTAGCGG - Intronic
1063769623 10:9183226-9183248 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1064197712 10:13259478-13259500 TGCCTGGGCTTCCACTTTGGTGG + Intergenic
1064460956 10:15534846-15534868 TGCCTGGGCTCCAACTTTGGCGG + Intronic
1064790426 10:18951762-18951784 TGCCTGGGTTCCCACTTTGGTGG - Intergenic
1065360524 10:24885042-24885064 TGCCTGGGCTTGCAGCCTGGAGG + Intronic
1065441267 10:25755877-25755899 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1065743344 10:28816158-28816180 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1065752233 10:28897260-28897282 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1065802537 10:29366071-29366093 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1065895826 10:30162731-30162753 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1066190189 10:33049102-33049124 TGCCTGGGCTCCCATTTTGGTGG + Intergenic
1066233972 10:33467910-33467932 TGCCTGGGCTCCCACTTCGGCGG + Intergenic
1066235538 10:33480948-33480970 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1066296031 10:34055431-34055453 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1066544312 10:36482480-36482502 TGCCTGGGCTTCCACTTTGGCGG - Intergenic
1066567471 10:36735103-36735125 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1068373948 10:56154999-56155021 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1068863100 10:61867521-61867543 TGCCTGGGCTCCTACTTTGGCGG + Intergenic
1068902043 10:62280253-62280275 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1068978065 10:63033465-63033487 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1069766076 10:70861520-70861542 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1069988608 10:72300488-72300510 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1069992901 10:72325832-72325854 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1070564137 10:77590671-77590693 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1070973319 10:80585754-80585776 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1070999084 10:80814088-80814110 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1071003683 10:80859112-80859134 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1071037551 10:81265398-81265420 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1071387935 10:85141276-85141298 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1071901056 10:90120259-90120281 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1072278429 10:93845065-93845087 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1073789839 10:106928577-106928599 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1074316938 10:112369665-112369687 TGCCTTGGCTCCCACTTTGGCGG + Intergenic
1074732409 10:116393281-116393303 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1074996420 10:118760631-118760653 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1074999162 10:118782778-118782800 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1075016101 10:118910910-118910932 TGCCTGGCCTGGCTCCTTGGAGG - Intergenic
1075255550 10:120923701-120923723 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1075269453 10:121035827-121035849 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1075305650 10:121365454-121365476 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1075537600 10:123283836-123283858 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1075707534 10:124510564-124510586 TTCCTGGGCTGGAACATTTGTGG - Intronic
1076261730 10:129071835-129071857 TGCCTGTGCTCCCACTTTGGCGG - Intergenic
1076710802 10:132332689-132332711 TGCCTGGGGTTGAACCCTGCTGG + Intronic
1076773542 10:132680538-132680560 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1076796606 10:132801420-132801442 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1077603179 11:3588604-3588626 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1077778273 11:5294873-5294895 TGCCTGGGCTCCCACATTGGTGG - Intronic
1077805691 11:5589756-5589778 TGCCTAGGCTCCCACTTTGGCGG + Intronic
1077815545 11:5682824-5682846 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1078251968 11:9623521-9623543 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1078301273 11:10133788-10133810 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1078743762 11:14091811-14091833 TGCCTGGGCTCCTACTTTGGCGG - Intronic
1078795755 11:14590946-14590968 TGCCTGGGCTCCCACTTTAGCGG + Intronic
1079555495 11:21753601-21753623 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1079726287 11:23883916-23883938 TGCCTGGGCTCCCACTTTGTTGG - Intergenic
1079767855 11:24416504-24416526 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1080195263 11:29600630-29600652 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1080557760 11:33432227-33432249 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1080621371 11:33989976-33989998 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1081115399 11:39193039-39193061 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1081124990 11:39311704-39311726 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1081329783 11:41788710-41788732 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1081420827 11:42873796-42873818 TGCCTGGGCTTCCACTTTGGTGG + Intergenic
1081428309 11:42949753-42949775 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1081451971 11:43179714-43179736 TTCCTGGCCTCCAACCCTGGAGG + Intergenic
1082272045 11:50183149-50183171 TGCCTGGGCTCCCACTTTGGAGG + Intergenic
1082698830 11:56402403-56402425 TGCCTGGGCTCCCACATTGGCGG - Intergenic
1083546041 11:63550082-63550104 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1083895353 11:65617054-65617076 TGCCTGGGCCGGAACCTTGCAGG + Intronic
1084107339 11:66988682-66988704 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1084259069 11:67963146-67963168 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1084406146 11:68974724-68974746 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1084694366 11:70744885-70744907 TACCTGGACTCAAGCCTTGGTGG - Intronic
1084813690 11:71632032-71632054 TGCCTGGGCTCCCACTTTGGAGG - Intergenic
1085074676 11:73580350-73580372 GGCCTGGGCTCTATCTTTGGAGG - Intronic
1085245533 11:75098084-75098106 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1085375813 11:76060441-76060463 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1085447317 11:76609513-76609535 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1086042961 11:82501036-82501058 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1086210188 11:84309019-84309041 TGCCTGGGCACCCACTTTGGCGG - Intronic
1086807946 11:91268633-91268655 TGCCTGGGCTCCTACTTTGGTGG + Intergenic
1087235284 11:95711257-95711279 TGTCTGGGCTCTAACCTTCGTGG - Intergenic
1087354467 11:97076476-97076498 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1087486457 11:98763893-98763915 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088570807 11:111221855-111221877 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1089062185 11:115634376-115634398 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1089373648 11:117978972-117978994 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1089466470 11:118689457-118689479 TGCCTGGACTCCCACTTTGGCGG - Intergenic
1089636945 11:119820919-119820941 TGCCTGGGCCCCGACCCTGGGGG + Intergenic
1089800168 11:121021536-121021558 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1090133625 11:124171181-124171203 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1090229153 11:125089373-125089395 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1090307756 11:125705186-125705208 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1090588189 11:128236967-128236989 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1090782654 11:130021549-130021571 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1090820591 11:130337843-130337865 TGCCTGGGCGCCCACTTTGGCGG - Intergenic
1091233529 11:134003346-134003368 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1092135136 12:6142073-6142095 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092137360 12:6159356-6159378 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092142177 12:6191354-6191376 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1092220224 12:6708182-6708204 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092221323 12:6715912-6715934 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1092272857 12:7037302-7037324 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1092336604 12:7639717-7639739 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092350592 12:7752544-7752566 TGCCTAGGCTCCCACTTTGGCGG - Intergenic
1092366475 12:7881157-7881179 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1092410995 12:8252674-8252696 TGCCTAGGCTCCCACTTTGGTGG - Intergenic
1092430387 12:8404152-8404174 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092471697 12:8787143-8787165 TGCCTGGGCTCCCAATTTGGTGG + Intergenic
1092472892 12:8794600-8794622 TGCCCGGGCTCCCACTTTGGTGG + Intergenic
1092572497 12:9740061-9740083 TGCCGGGGCTCCCACTTTGGTGG - Intergenic
1092583878 12:9876524-9876546 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1092617230 12:10226116-10226138 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1092732399 12:11547169-11547191 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1092834276 12:12472884-12472906 TGCCTGGGCTTCCACTTTGGCGG - Intergenic
1093189327 12:16057259-16057281 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1093266205 12:17007501-17007523 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1093381492 12:18500024-18500046 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1093652478 12:21661407-21661429 TGCCTGGGCTCCCCCTTTGGGGG + Intronic
1093793649 12:23285822-23285844 TGCCTGGGCTCCTACTTTGGTGG + Intergenic
1093970146 12:25369250-25369272 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1094327491 12:29256520-29256542 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1094338683 12:29386724-29386746 TGCCTGGGCTCCCACTCTGGCGG - Intergenic
1094409765 12:30156748-30156770 GGCCTGGGCTCCCACTTTGGCGG + Intergenic
1094448646 12:30561510-30561532 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1094589379 12:31806273-31806295 TGCCTGGGCTCCCAGTTTGGTGG - Intergenic
1094661207 12:32472168-32472190 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1094666414 12:32525550-32525572 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1094843945 12:34353306-34353328 TCCGTGGGCATGAACCTTGGGGG + Intergenic
1094844269 12:34354574-34354596 TCCGTGGGCGCGAACCTGGGAGG + Intergenic
1094844448 12:34355289-34355311 TCCCTGGGCACGAACCTGGGAGG + Intergenic
1095123028 12:38441829-38441851 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1095304091 12:40620558-40620580 TGCCTGGGCTCGCACGTTGGCGG + Intergenic
1095533904 12:43224199-43224221 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1095776633 12:46017896-46017918 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1096301462 12:50431802-50431824 TTCCTGGGCTCCAGCCTGGGCGG + Intronic
1097017995 12:56000627-56000649 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1097129010 12:56796323-56796345 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1097212875 12:57386189-57386211 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1098168287 12:67719715-67719737 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1098588596 12:72184916-72184938 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1098759168 12:74402823-74402845 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1099523998 12:83696770-83696792 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1099559688 12:84155604-84155626 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1099716298 12:86296876-86296898 TGCCTGGGCTCCCACTTCGGCGG - Intronic
1099790642 12:87330092-87330114 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1100211957 12:92407002-92407024 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1100521393 12:95379485-95379507 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1100584629 12:95969010-95969032 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1100600570 12:96108781-96108803 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1100734691 12:97513221-97513243 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1101008914 12:100430178-100430200 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1101462037 12:104905997-104906019 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1102309688 12:111835531-111835553 TGCCTGGGCTCTCACTTTGGTGG + Intergenic
1102387308 12:112520373-112520395 TGCCTGGGCTCCCATTTTGGCGG - Intergenic
1103146217 12:118597659-118597681 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1103459726 12:121093991-121094013 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1103668472 12:122591901-122591923 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1103783471 12:123414597-123414619 TGCCTGGGCTCCCACTTTGGCGG - Exonic
1103853218 12:123946822-123946844 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1104582567 12:130021931-130021953 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1104614592 12:130257138-130257160 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1104772028 12:131369481-131369503 TTCCGGGGCACTAACCTTGGAGG + Intergenic
1104946325 12:132416447-132416469 TGCCCTGGCTCGAAGCTGGGTGG - Intergenic
1105037678 12:132938630-132938652 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1105722109 13:23127453-23127475 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1105876758 13:24561189-24561211 TGCCTGGGTTCCCACTTTGGCGG - Intergenic
1106221401 13:27748798-27748820 TGCGTGGGCTCCCACTTTGGCGG - Intergenic
1106600620 13:31183492-31183514 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1106617139 13:31340150-31340172 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1106810876 13:33357857-33357879 TGCCTGGGCTCTCACTTTGGTGG + Intergenic
1107259454 13:38472914-38472936 TGCCTGGGCTCCCATTTTGGCGG - Intergenic
1107297113 13:38921379-38921401 TGCCTGGGCTTGAACCAGGGAGG + Intergenic
1107590535 13:41899063-41899085 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1107836038 13:44413452-44413474 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1108099252 13:46936538-46936560 TGCCTGGGCTCCCCCTTTGGCGG - Intergenic
1108435270 13:50396471-50396493 TGCCTGGGCTCCCACTTTGACGG + Intronic
1108469523 13:50753789-50753811 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1108644049 13:52408564-52408586 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1108751604 13:53452876-53452898 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1108851684 13:54737760-54737782 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1108856588 13:54800162-54800184 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1108859031 13:54829984-54830006 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1108995942 13:56735486-56735508 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1109124767 13:58504710-58504732 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1109140971 13:58713960-58713982 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1109441296 13:62379103-62379125 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1109446682 13:62448382-62448404 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1109563231 13:64077978-64078000 TGCCTGGGCTCCCAATTTGGCGG - Intergenic
1109741465 13:66560942-66560964 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1109745745 13:66621825-66621847 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1110024137 13:70512389-70512411 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1110344093 13:74426201-74426223 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1110368794 13:74718269-74718291 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1110417414 13:75268325-75268347 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1110792468 13:79600642-79600664 TGCCTAGGCTCCCACTTTGGCGG - Intergenic
1110862061 13:80355423-80355445 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1110874442 13:80491045-80491067 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1110913999 13:80998911-80998933 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1110940373 13:81341254-81341276 TGCCTGGGCTCCCACTTTGGAGG - Intergenic
1110999913 13:82165434-82165456 TGCCTGGGATCCCACTTTGGCGG - Intergenic
1111441836 13:88291697-88291719 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1111590952 13:90348477-90348499 TGCCTGGGCTCCCACATTGGCGG + Intergenic
1111602661 13:90494696-90494718 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1111652656 13:91111650-91111672 TGCCTGGGCATGAAGCTTGTTGG - Intergenic
1111747620 13:92290765-92290787 TGTCTGGGCTCCCACTTTGGCGG + Intronic
1111748254 13:92296542-92296564 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1111841488 13:93455269-93455291 TGCCCGGGCTCCCACTTTGGCGG - Intronic
1112519751 13:100084874-100084896 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1112538209 13:100282324-100282346 TGCCTGGGCTCCAACTTTGGCGG + Intronic
1112613026 13:100975573-100975595 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1112705787 13:102068351-102068373 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1112842631 13:103599858-103599880 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1113482757 13:110633513-110633535 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1113506563 13:110821035-110821057 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1114560386 14:23585366-23585388 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1114593462 14:23891633-23891655 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1116114566 14:40630122-40630144 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1116251100 14:42482873-42482895 TGCCTGGGCTCCTACTTTGGTGG - Intergenic
1116390454 14:44384619-44384641 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1116452287 14:45080313-45080335 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1117066891 14:52019953-52019975 AGCCTGGTCTGGAGCCTTGGTGG - Intronic
1117077796 14:52122119-52122141 TGCCTGGGCTTCCACTTTGGCGG + Intergenic
1117297505 14:54393338-54393360 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1117302440 14:54442928-54442950 TGCCTGGGCTGCCACTTTGGCGG + Intergenic
1117449748 14:55839385-55839407 TGCCTGGGCTCCCGCTTTGGCGG + Intergenic
1117571999 14:57057099-57057121 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1117912794 14:60650195-60650217 TGCCTGGTCTCAAATCATGGAGG - Intronic
1118215435 14:63803746-63803768 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1118306259 14:64658055-64658077 TGCCTTGGCTCCCACTTTGGCGG + Intergenic
1119038766 14:71254171-71254193 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1119300388 14:73566817-73566839 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1119391659 14:74295184-74295206 TGCATGTGCTTGAACCTGGGCGG + Exonic
1119486704 14:74994031-74994053 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1119870769 14:78014465-78014487 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1120330915 14:83092261-83092283 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1120439182 14:84513392-84513414 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1120844090 14:89111524-89111546 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1121350726 14:93170567-93170589 TGCCTGGACTCCCACTTTGGCGG - Intergenic
1122001788 14:98664328-98664350 TTCCTTGGCTGGAACCTTTGGGG + Intergenic
1122493532 14:102135994-102136016 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1123799067 15:23802790-23802812 TGCCTGGGCTCCCACTTTAGGGG + Intergenic
1123949206 15:25253677-25253699 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1124114932 15:26831663-26831685 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1124351888 15:28961775-28961797 TGCCTGGGCTCCACTCCTGGAGG + Intronic
1124380413 15:29160359-29160381 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1124573051 15:30883633-30883655 TGCCTAGGCTCCCACTTTGGTGG + Intergenic
1125112141 15:36046830-36046852 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1125480367 15:40075255-40075277 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1125565823 15:40677411-40677433 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1125914622 15:43474362-43474384 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1126088921 15:45034711-45034733 TGCCTGGGCTCCCGCTTTGGCGG + Intronic
1126128004 15:45313969-45313991 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1126639602 15:50811853-50811875 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1128110774 15:65074901-65074923 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1128598641 15:68976152-68976174 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1128670044 15:69567840-69567862 TGCCTGGGCTCCAACTTTGGCGG - Intergenic
1128813378 15:70587649-70587671 TGCCTGGGCTCTCACTTTGGCGG - Intergenic
1129208565 15:74052415-74052437 TGCCTTGGCTCCCACTTTGGCGG + Intergenic
1129280467 15:74480828-74480850 TGCCTGGGCTCCCAGTTTGGCGG - Intergenic
1129374076 15:75116429-75116451 TGCCTGGGCTCCCACTATGGCGG - Intronic
1129859094 15:78846750-78846772 TGCCTGGGATCCCACTTTGGCGG + Intronic
1129997083 15:80016399-80016421 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1131212626 15:90510836-90510858 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1131472892 15:92711501-92711523 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1131507719 15:93031705-93031727 TGCCTGGGCTCTCACTTTGGCGG + Intergenic
1131846195 15:96492321-96492343 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1132510948 16:341143-341165 TGCCTGGGCTCTCACTTTGGTGG + Intronic
1132836891 16:1958655-1958677 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1133362715 16:5186805-5186827 TGCCTGGACTCCCACTTTGGTGG - Intergenic
1133382375 16:5341914-5341936 TGCCAGGGCTGGAGCCATGGGGG + Intergenic
1135262197 16:20990124-20990146 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1135280781 16:21152474-21152496 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1135299462 16:21313264-21313286 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1135751142 16:25059394-25059416 TGCCTGGGCTCCCACTTTAGCGG - Intergenic
1136163227 16:28435246-28435268 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1136199738 16:28679741-28679763 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1136216086 16:28793914-28793936 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1137442442 16:48508579-48508601 TGCCTGCGCTCTCACTTTGGCGG + Intergenic
1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG + Intronic
1139125613 16:64072811-64072833 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1139147666 16:64343772-64343794 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1139602981 16:67998092-67998114 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1139919662 16:70451279-70451301 TGCCTGGGCTCCCGCTTTGGCGG - Intergenic
1141465810 16:84205065-84205087 TGCCTGCGCTCCCACTTTGGCGG - Intergenic
1141544141 16:84752438-84752460 TGCCTGCCCTCTATCCTTGGTGG + Intronic
1141690597 16:85594208-85594230 GGCCTGGGCCCGATCCCTGGGGG + Intergenic
1143283292 17:5771121-5771143 TGCCTGGGCTCTCACTTTGGTGG + Intergenic
1143460572 17:7101011-7101033 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1143664350 17:8347603-8347625 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1144467079 17:15505574-15505596 TGCCAGGGCTCCCACTTTGGCGG + Intronic
1144716226 17:17437623-17437645 TGTCTGGGCTCCATCCTTGTGGG + Intergenic
1146740540 17:35279397-35279419 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1147373551 17:40010810-40010832 TGCCTGGGCTCCCACTTCGGTGG + Intergenic
1147431748 17:40375703-40375725 TGCCTGGGCTCCCACTTCGGTGG + Intergenic
1147997460 17:44368700-44368722 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1148016795 17:44527842-44527864 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1148023304 17:44568094-44568116 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1148366250 17:47057766-47057788 TGCCTGGGCTCCCTCTTTGGCGG - Intergenic
1149099329 17:52884442-52884464 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1150140815 17:62727053-62727075 TTCCTGGGCTCCACCCTTAGAGG + Intronic
1150778206 17:68099160-68099182 TCCCTGGGCTCCCACTTTGGCGG + Intergenic
1150786811 17:68169840-68169862 TGCCTGGGATCCTACTTTGGCGG - Intergenic
1150804676 17:68309390-68309412 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1151782749 17:76258132-76258154 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1151855130 17:76715643-76715665 TGCCTGGGCTGGAGCGTTGGAGG - Exonic
1152379912 17:79937078-79937100 TGCCAAGGCTCCACCCTTGGAGG - Exonic
1153644132 18:7179149-7179171 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1153832540 18:8935906-8935928 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1154128829 18:11717387-11717409 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1155208125 18:23578114-23578136 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1155272027 18:24150034-24150056 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1155295104 18:24377069-24377091 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1155772800 18:29723394-29723416 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1155852211 18:30788321-30788343 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1155856448 18:30839641-30839663 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1155976713 18:32139742-32139764 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1156038595 18:32794452-32794474 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1156863589 18:41865634-41865656 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1156943104 18:42795125-42795147 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1157085899 18:44580610-44580632 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1157979872 18:52367386-52367408 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1158351845 18:56572167-56572189 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1158697333 18:59714575-59714597 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1158705827 18:59790934-59790956 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1159168025 18:64726113-64726135 TGCCTGGGCTCCTACTTTAGTGG - Intergenic
1159230721 18:65605131-65605153 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1159473022 18:68880478-68880500 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1159656181 18:71031822-71031844 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1160176694 18:76600613-76600635 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1160198478 18:76777122-76777144 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1160200132 18:76789016-76789038 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1162018850 19:7859715-7859737 CCCCTGAGCTCCAACCTTGGGGG + Intronic
1162106927 19:8375637-8375659 TGCCTGGGCTCCCACTGTGGCGG + Intronic
1162230070 19:9259391-9259413 TGCCTGGGCTTCCACTTTGGCGG + Intergenic
1162233189 19:9283938-9283960 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1162237576 19:9321277-9321299 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1162419828 19:10559758-10559780 TCCCTGGGCCTGAACCCTGGGGG + Intronic
1162632774 19:11941778-11941800 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1162814802 19:13187180-13187202 TGCCTGGGCTTCCACTTTGGCGG - Intergenic
1163181796 19:15609128-15609150 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1163218733 19:15899207-15899229 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1164144098 19:22499472-22499494 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1164270661 19:23669010-23669032 TGCCTGGGCTCCTACTTTGGCGG - Intronic
1164828511 19:31302008-31302030 TGACTGGGCTGGGATCTTGGAGG - Intronic
1164975722 19:32571465-32571487 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1165266864 19:34668071-34668093 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1166036298 19:40170624-40170646 TGCCTGGGCTCCCACTCTGGCGG - Intergenic
1166649801 19:44563688-44563710 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
925147722 2:1592104-1592126 CGCCTGGGCTCGCATCTGGGTGG + Intergenic
925537881 2:4935797-4935819 TGCCTGGGCTCCCACTATGGCGG - Intergenic
926206403 2:10837070-10837092 TGCCTGGGCTTGATGCTGGGAGG + Intronic
926444605 2:12926993-12927015 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
926850600 2:17193431-17193453 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
927357010 2:22186220-22186242 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
927777733 2:25915378-25915400 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
927900358 2:26814348-26814370 TGCTTGGGCTCCCACTTTGGTGG + Intergenic
928753122 2:34494169-34494191 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
928936823 2:36688138-36688160 GGCCTGGGCTCCCACTTTGGCGG + Intergenic
929069979 2:38020390-38020412 TGCCTGGGCTCCCACTTTGGCGG + Intronic
929201784 2:39244152-39244174 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
929379615 2:41335467-41335489 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
929890950 2:45918157-45918179 TGCCTGGGCTCCCACTCTGGCGG - Intronic
930037942 2:47099609-47099631 TGCCTGGGCTCCCACTTTGGCGG + Intronic
930039138 2:47107157-47107179 TGCCTGGGCTCCCACTTTGGCGG + Intronic
930468288 2:51780770-51780792 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
930485435 2:52006676-52006698 TGCCTGGGCTGCCACTTTGGTGG + Intergenic
931708622 2:64968881-64968903 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
932239863 2:70148205-70148227 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
932486399 2:72086766-72086788 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
932521704 2:72421705-72421727 TGCCTGGGCTCCCACTTTGGCGG + Intronic
933487328 2:82938928-82938950 TGCCTGGGTTCCCACTTTGGCGG - Intergenic
933511537 2:83246409-83246431 TGCCTGTGCTCCCACTTTGGTGG - Intergenic
933712217 2:85334834-85334856 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
934898425 2:98138880-98138902 TGCCTGGGCTCCCACTTTGGCGG + Intronic
935896929 2:107747820-107747842 TGCCTGGGCTCCCAGTTTGGCGG - Intergenic
936172772 2:110190676-110190698 TGCCTGGGCTCCCACTTTGGCGG - Intronic
936346811 2:111681727-111681749 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
937181063 2:119996861-119996883 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
937209672 2:120260235-120260257 TGCCTGGGCTCCCACTTTGGTGG - Intronic
937596777 2:123683650-123683672 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
937711915 2:124987866-124987888 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
937746529 2:125422123-125422145 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
938931273 2:136088506-136088528 TGCCTGGGCTCACATTTTGGCGG - Intergenic
939053290 2:137332090-137332112 TGCCTGGGCTTCCACTTTGGCGG - Intronic
939229683 2:139410218-139410240 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
939281683 2:140073673-140073695 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
939509653 2:143089918-143089940 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
939738856 2:145881394-145881416 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
939777426 2:146404175-146404197 TGCCTGGGCTCCCATTTTGGCGG - Intergenic
939972606 2:148678871-148678893 TGCCTGGGCTCCCACTTTGGCGG - Intronic
940215030 2:151295886-151295908 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
940666778 2:156618543-156618565 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
940784671 2:157968354-157968376 TGCCTGGGCTCCCACTTTGGCGG - Intronic
941186785 2:162327992-162328014 TGCCTGGGCTCCCACTTTGGCGG + Intronic
941240008 2:163026147-163026169 GGCCTGGGCTCCCACTTTGGCGG + Intergenic
941398007 2:164995240-164995262 GGCCTGGGCTCCCACTTTGGCGG - Intergenic
941705945 2:168657922-168657944 TGCCTGGGCTCCCACTTCGGTGG - Intronic
941712195 2:168725381-168725403 TGCCTGGGCTCCCACTTTGGCGG - Intronic
941820715 2:169841409-169841431 TGCCTGGACTCCCACTTTGGTGG + Intronic
942299668 2:174549030-174549052 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
942867214 2:180691264-180691286 TGCCTTGGCTCCCACTTTGGCGG + Intergenic
943494824 2:188606877-188606899 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
943680424 2:190761447-190761469 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
943906184 2:193502892-193502914 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
944228362 2:197370449-197370471 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
944729566 2:202503260-202503282 TGCCTGGGCTCCCACTTTGGCGG + Intronic
944843205 2:203643310-203643332 TGCCTGGGCTCCCAATTTGGTGG - Intergenic
944858006 2:203786059-203786081 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
945575551 2:211524859-211524881 TGCCTGGGCTCCCACTTTGGCGG - Intronic
945745704 2:213718367-213718389 TGCCTGGGCTCCCACTTTGGTGG + Intronic
945872903 2:215246216-215246238 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
946358161 2:219201911-219201933 TGCCTGGGCTCCCACTTTGGTGG - Intronic
946923640 2:224604185-224604207 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
946982242 2:225229932-225229954 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
947026557 2:225744006-225744028 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
947411915 2:229850595-229850617 TGCCTGGCCTCCAACTTTGGCGG + Intronic
947932131 2:233972951-233972973 TGCCTGGGCTCCCACTTTGGCGG - Intronic
948116504 2:235497375-235497397 TGCCTGTGCGTGCACCTTGGAGG + Intronic
948449189 2:238058341-238058363 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1169645417 20:7804000-7804022 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1169814532 20:9642073-9642095 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1169849121 20:10031558-10031580 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1170246401 20:14226387-14226409 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1170534439 20:17325946-17325968 TGCCTGGGCTAGGCCCCTGGTGG - Intronic
1170806922 20:19640117-19640139 TGCCTGGGCTCCCACTTTGGAGG - Intronic
1170989811 20:21291751-21291773 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1171250730 20:23645122-23645144 TGCCGTGGCTCCAACCCTGGGGG + Intergenic
1171318926 20:24221204-24221226 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1172431933 20:34899286-34899308 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1172636222 20:36411716-36411738 TGCCTGGGCTCAGATCCTGGAGG - Intronic
1173195599 20:40910954-40910976 TGCCTGGGCTCCCACTTTAGCGG - Intergenic
1173601524 20:44299010-44299032 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1173615211 20:44399013-44399035 GGCCTGGGCTCAGCCCTTGGAGG + Intronic
1174910361 20:54601559-54601581 TGCCTGGACTTGAAGGTTGGTGG - Intronic
1175209989 20:57348273-57348295 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1175254079 20:57628678-57628700 TGCCTGCGCTCCCACTTTGGCGG + Intergenic
1176200268 20:63857007-63857029 TGCCAGGGCAGGAACCCTGGGGG + Intergenic
1176332347 21:5560073-5560095 TGCCTGGGCTCCAACTTTGGCGG - Intergenic
1176395410 21:6260878-6260900 TGCCTGGGCTCCAACTTTGGCGG + Intergenic
1176441747 21:6728226-6728248 TGCCTGGGCTCCAACTTTGGCGG - Intergenic
1176466009 21:7055295-7055317 TGCCTGGGCTCCAACTTTGGCGG - Intronic
1176489570 21:7437073-7437095 TGCCTGGGCTCCAACTTTGGCGG - Intergenic
1176706729 21:10123679-10123701 ACCCTGGGCTCGAACCATGGAGG - Intergenic
1176966698 21:15219067-15219089 TGCCTGGGCTCCCACTTCGGTGG - Intergenic
1177496857 21:21902294-21902316 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1177565901 21:22819323-22819345 TGCCTGGGCTCTCCCTTTGGCGG - Intergenic
1177637538 21:23806894-23806916 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1178082284 21:29077601-29077623 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1178387649 21:32166789-32166811 TCCCTGTGCTTGAACCTGGGTGG + Intergenic
1178398667 21:32265208-32265230 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1179461122 21:41536059-41536081 TGCCTGGGCATGAACCCTAGGGG + Intergenic
1180006900 21:45027016-45027038 TGCCTGGGCTGGACCTGTGGTGG - Intergenic
1183422198 22:37718323-37718345 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1183685141 22:39357414-39357436 TGCCTGGGCTCCTACTTTGGCGG + Intronic
949258903 3:2083509-2083531 TGCCCGGGCTCCCACTTTGGCGG + Intergenic
950256727 3:11512079-11512101 TGCCTGGGCTCCCACTTTGGTGG - Intronic
950257036 3:11513726-11513748 TGCCTGGGCTCCCACTTTGGCGG - Intronic
950470097 3:13179632-13179654 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
950513443 3:13447680-13447702 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
950600443 3:14029975-14029997 TGCCTAGGCTCCCACTTTGGTGG - Intronic
950632572 3:14293098-14293120 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
950639679 3:14340658-14340680 TGCCTGGGCTTGAACCACAGGGG + Intergenic
950929327 3:16773594-16773616 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
951146653 3:19234726-19234748 TGCCTGGGCTCCTACTTTGGCGG - Intronic
951682239 3:25306885-25306907 TGGCTTGGCTCCATCCTTGGTGG + Intronic
951734731 3:25851642-25851664 TGCCTGGGCTCCTACTTTGGCGG + Intergenic
951951161 3:28200897-28200919 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
952058159 3:29473985-29474007 TGCCTGGACTCCCACTTTGGTGG - Intronic
952260120 3:31731889-31731911 GACCTGGCCTCAAACCTTGGGGG + Intronic
952275172 3:31869998-31870020 TGCCTGGGCTCCCACTTTGGTGG + Intronic
952355316 3:32578631-32578653 TGCCTGGACTCCCACTTTGGTGG + Intergenic
952393640 3:32902671-32902693 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
952398162 3:32939560-32939582 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
952593562 3:34988241-34988263 TCCCTGGGCTCCCACTTTGGCGG + Intergenic
952713243 3:36453222-36453244 TGCCTGGGCTCCTACTTTGGCGG + Intronic
952730565 3:36633784-36633806 TGCCTGGGCTCCCACTTTGACGG + Intergenic
952795173 3:37232881-37232903 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
952905927 3:38139043-38139065 TTCCTGGCCTCGTACCTGGGGGG + Intronic
952937578 3:38412307-38412329 TGCCTGGGCTGTAACCTGGTTGG + Intronic
953002815 3:38951029-38951051 TGCCTGGGCTCCCAATTTGGCGG + Intergenic
953089749 3:39713193-39713215 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
953124579 3:40078401-40078423 TGCCTGGGCTCCCACTTTGGCGG - Intronic
953307676 3:41844648-41844670 TGCCTGGGCTCCCACTTTGGCGG - Intronic
953522564 3:43656909-43656931 TGCCTGGGCTCCCACTTTGGCGG - Intronic
953741831 3:45545067-45545089 TGCCTGGGGTGGAGCCTAGGTGG + Intronic
954040934 3:47887083-47887105 TGCCTGGGTTCCCACTTTGGCGG + Intronic
954620048 3:51990434-51990456 TGCCTCGGCTCCCACTTTGGTGG + Intergenic
955183278 3:56691757-56691779 TGCCTGGGCTCCCAATTTGGCGG + Intergenic
955186352 3:56718811-56718833 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
955266530 3:57449829-57449851 TGCCTGGGTTCCCACTTTGGCGG - Intronic
955449411 3:59050735-59050757 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
956195666 3:66651448-66651470 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
956384846 3:68705526-68705548 TGCCTTTGCTTGAACCTGGGAGG + Intergenic
956392255 3:68785749-68785771 TGCCTGGGCTCCCACTTTGGTGG - Intronic
956481389 3:69677330-69677352 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
956748727 3:72329752-72329774 AGCCTGGGTTGGAATCTTGGAGG - Intergenic
956855184 3:73269070-73269092 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
957002333 3:74900417-74900439 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
957009256 3:74985609-74985631 TGCCTGGGCTGCCACTTTGGCGG - Intergenic
957056230 3:75444897-75444919 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
957074014 3:75587676-75587698 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
957277390 3:78108267-78108289 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
957362010 3:79173215-79173237 TACCTGGGCTCCCACTTTGGTGG + Intronic
957371410 3:79300097-79300119 TGCCTGGGCTCCCACTTTGGCGG + Intronic
957419741 3:79951854-79951876 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
957446067 3:80314380-80314402 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
957560233 3:81812466-81812488 TGCCTGGGCTCCCAATTTGGCGG - Intergenic
957665257 3:83218094-83218116 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
957804983 3:85134344-85134366 TGCCTGGGCTCCCACTTTGGCGG - Intronic
957830097 3:85505158-85505180 TGCCTGGGCTCCCACTTTGGCGG - Intronic
957921743 3:86757470-86757492 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
957995029 3:87678974-87678996 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
958022558 3:88015567-88015589 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
958108230 3:89105117-89105139 TTCCTGGGTTCCAACCTCGGAGG + Intergenic
958419809 3:93917492-93917514 TGCCTGGGCTCCCACTTTGGCGG + Intronic
960149877 3:114238773-114238795 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
960199475 3:114813137-114813159 TGCCTGGGCTCCCACTTTGGCGG - Intronic
960227603 3:115185365-115185387 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
960761739 3:121079037-121079059 TGCCTGGGCTCCCACTTTGGTGG - Intronic
961280069 3:125759061-125759083 TACCTGGGCTCCCACTTTGGCGG - Intergenic
961460392 3:127046554-127046576 TGCCTGGACTCCCACTTTGGCGG + Intergenic
961721886 3:128902672-128902694 TGCCCCGGCTCCAACCCTGGAGG + Intronic
961874335 3:130010518-130010540 TGTCTGGGCTCCCACTTTGGCGG + Intergenic
962283822 3:134070742-134070764 TGCCTGGGCTCCCACTTTGGCGG - Intronic
962398822 3:135039901-135039923 TGCCTGGGCTCCCACTTTGGTGG - Intronic
963397133 3:144749689-144749711 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
963440337 3:145333271-145333293 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
963509221 3:146225909-146225931 TGCCTGGGCTCCCACTTCGGCGG - Intronic
963590044 3:147246036-147246058 TGCCTGGGCTCCCACTTTGGAGG - Intergenic
963651892 3:147989863-147989885 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
963673575 3:148281001-148281023 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
963862093 3:150322845-150322867 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
964014301 3:151928032-151928054 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
964032251 3:152152293-152152315 TGCTTGGGCTCCCACTTTGGCGG + Intergenic
964037471 3:152217181-152217203 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
964118045 3:153156203-153156225 TGCCTGGGCTCCCACTTCGGCGG - Intergenic
964139297 3:153378820-153378842 TGCCCGGGCTCCCACTTTGGTGG - Intergenic
964381031 3:156099345-156099367 TGCCTGGGCTCCCACTTTGGCGG + Intronic
964443931 3:156740455-156740477 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
964452213 3:156823160-156823182 TGCCTGGGCTCCCACTTTAGTGG - Intergenic
964802958 3:160574427-160574449 TGCGTGGGCTCCCACTTTGGCGG - Intergenic
964974098 3:162599576-162599598 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
964977689 3:162639948-162639970 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
965040226 3:163498901-163498923 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
965044204 3:163552804-163552826 TGCCTGGGCTCCCACTTCGGCGG - Intergenic
965077927 3:164002848-164002870 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
965109499 3:164402395-164402417 TGCCTGGGCTCCCACTTTGGGGG - Intergenic
965200418 3:165649800-165649822 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
965220280 3:165918929-165918951 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
965245311 3:166258951-166258973 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
965256720 3:166423854-166423876 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
965287965 3:166842689-166842711 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
965298055 3:166975711-166975733 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
965353024 3:167639093-167639115 TGCCTAGGCTAGAAACTTGGGGG + Intronic
965446404 3:168780018-168780040 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
965753305 3:171999354-171999376 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
965837296 3:172866661-172866683 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
966076002 3:175937252-175937274 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
966096866 3:176213897-176213919 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
966191089 3:177272210-177272232 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
966478804 3:180381852-180381874 TAGCTGGGCTCAGACCTTGGTGG - Intergenic
966724929 3:183100774-183100796 TGCCTGGGCTCCCACTTTGGTGG + Intronic
966725508 3:183104229-183104251 TGCCTGGGCTCCCAGTTTGGCGG - Intronic
966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG + Exonic
967278426 3:187799048-187799070 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
967448433 3:189596002-189596024 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
967499225 3:190177532-190177554 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
967684500 3:192404319-192404341 TGAGTGGCCACGAACCTTGGAGG - Intronic
967718271 3:192788909-192788931 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
968181672 3:196599520-196599542 TGCCTGGGCTTCCACTTTGGCGG - Intergenic
968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG + Intronic
968641301 4:1716405-1716427 AGCCTGGGCTGGACCCCTGGTGG + Exonic
968716089 4:2161147-2161169 TGCCTGGGCTCCCACTTTGGCGG + Intronic
968999040 4:3965176-3965198 TGCCTGGGCTCCCACTTCGGCGG - Intergenic
969017647 4:4115278-4115300 TGCCTGGGGTCCCACTTTGGTGG + Intergenic
969440667 4:7215006-7215028 TGCCTGGGCTCCCACTTTGGCGG + Intronic
969648264 4:8446762-8446784 TGCCTGGCCTCGAGTCTGGGTGG + Intronic
969655044 4:8491892-8491914 TGCCTGGGCTCCCACTTTGGCGG - Intronic
969754963 4:9143455-9143477 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
969795541 4:9524896-9524918 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
970182528 4:13415281-13415303 TGCCTGAGCTCCCACTTTGGCGG + Intronic
970391143 4:15614791-15614813 TGCCTGGGCCCCCACTTTGGCGG + Intronic
970649396 4:18159752-18159774 TGCCTGGGCTCGCACTTTGGTGG - Intergenic
970673235 4:18418821-18418843 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
970803453 4:20003891-20003913 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
971043580 4:22780700-22780722 TTGCTGGGCTCAAACCTTGAAGG + Intergenic
971377193 4:26064463-26064485 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
971553108 4:27978818-27978840 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
971563495 4:28112658-28112680 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
971639748 4:29117230-29117252 TGCCTGGGCTACCACTTTGGCGG + Intergenic
971811878 4:31438529-31438551 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
971852022 4:31996266-31996288 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
972022853 4:34336124-34336146 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
972034863 4:34507061-34507083 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
972392485 4:38626782-38626804 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
972778544 4:42265816-42265838 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
972900056 4:43672235-43672257 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
973037029 4:45420040-45420062 TGCCTCGGCTCCCACTTTGGCGG + Intergenic
973308009 4:48675218-48675240 TGCCTGGGCTCCCATTTTGGTGG + Intronic
973587830 4:52410228-52410250 TGCCTGGGCTCCCAATTTGGTGG - Intergenic
973765167 4:54155606-54155628 TGCCTGGGCTCCCACTTTGGCGG - Intronic
973817513 4:54632414-54632436 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
974590669 4:63943358-63943380 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
974641815 4:64640956-64640978 TGCCTAGGCTCCCACTTTGGTGG - Intergenic
974781819 4:66561964-66561986 TGCCTGGGCTCCTGCTTTGGCGG - Intergenic
974792836 4:66712896-66712918 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
974804312 4:66860046-66860068 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
974992942 4:69115726-69115748 TGCCTGGGCTCCCACTTTGGTGG - Intronic
975055335 4:69923769-69923791 TGCCTGGGCTCCCACTTTGACGG + Intergenic
975298747 4:72765776-72765798 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
975440028 4:74399545-74399567 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
975595254 4:76043769-76043791 TGCCTGGGCTTCCACTTTGGCGG - Intronic
975596439 4:76051139-76051161 TGCCTGGGCTCCCACTTTGGCGG - Intronic
975898358 4:79121810-79121832 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
976406314 4:84664595-84664617 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
976520701 4:86022091-86022113 TGCCTGGGCTCCTACTTTGGCGG - Intronic
976565466 4:86547198-86547220 TGCCTGGGTTCCCACTTTGGCGG + Intronic
976646937 4:87396429-87396451 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
976846005 4:89489934-89489956 TGCCTGGGCACCCACTTTGGCGG + Intergenic
976980371 4:91218453-91218475 TGCCTGGGCTCCCACTTTGGCGG - Intronic
977717421 4:100197003-100197025 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
977751033 4:100609243-100609265 TGCCTGGGCTCCCACTTTGGCGG - Intronic
977906426 4:102483014-102483036 TGCCTGGGCTCCTACTTTGGCGG + Intergenic
978241954 4:106525826-106525848 TGCCTGGGCTCTCACTTTGGCGG - Intergenic
978463687 4:108984835-108984857 TGCCTGGGCTCCCACTTTGGCGG - Intronic
978998122 4:115179899-115179921 TGCCTGGGCTCCCACTTTGTTGG - Intergenic
978999646 4:115200679-115200701 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
979290891 4:118977529-118977551 TGCCTGGGCTCCCACTTTGGTGG - Intronic
979308245 4:119173658-119173680 TGCCTGGGCTCCCACTTTGGCGG + Intronic
979424824 4:120551221-120551243 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
979688512 4:123537795-123537817 TGCCTGGGCTCCCACTTTGGGGG + Intergenic
979755798 4:124338930-124338952 TGCCTGGGCTCCCGCTTTGGCGG + Intergenic
979814851 4:125087808-125087830 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
979822483 4:125191828-125191850 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
979825778 4:125230072-125230094 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
979899789 4:126201773-126201795 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
980043455 4:127964720-127964742 TGCCTGGGCTCCCACTTTGGCGG - Intronic
980052007 4:128048041-128048063 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
980115149 4:128672540-128672562 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
980227907 4:130012664-130012686 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
980230321 4:130039025-130039047 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
980470298 4:133240891-133240913 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
980628524 4:135406495-135406517 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
980799693 4:137733614-137733636 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
980815480 4:137941948-137941970 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
981146848 4:141333678-141333700 TGTCTGGGCTCCCACTTTGGCGG - Intergenic
981176653 4:141690341-141690363 TGCCTGGGCTCCCACTTTGGCGG - Intronic
981213151 4:142132339-142132361 AGCCTGGGTTCTAACCCTGGTGG - Intronic
981275754 4:142897380-142897402 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
982408156 4:155044181-155044203 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
982631703 4:157838459-157838481 TCCCTGAGCTATAACCTTGGTGG - Intergenic
982728118 4:158927579-158927601 TGCCTGGGCTCCCACTTTGGCGG + Intronic
982814655 4:159869518-159869540 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
982868881 4:160550603-160550625 TGCCTGGACTCCCACATTGGCGG - Intergenic
983064157 4:163190188-163190210 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
983230731 4:165126420-165126442 TGCCTGGGCTCCCACTTTGGCGG - Intronic
983752773 4:171298146-171298168 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
984238894 4:177193677-177193699 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
984241897 4:177228009-177228031 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
984265583 4:177495470-177495492 TGCCCGGGCTCCCACTTTGGCGG + Intergenic
984486134 4:180372334-180372356 TGCCTGGTCTCGAACCTCAACGG + Intergenic
984662182 4:182386438-182386460 TGCCTGGGTTCCCACTTTGGCGG + Intronic
984776181 4:183483146-183483168 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
984948799 4:184990571-184990593 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
985087023 4:186324462-186324484 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
985145358 4:186889993-186890015 TGCCTGGGCTCCCACTTTGACGG + Intergenic
985203178 4:187505509-187505531 TGCCTGGGCTCCCACTTTGGGGG + Intergenic
985366325 4:189236185-189236207 TGCCTGGGCTCCCACTTTGGGGG + Intergenic
985403946 4:189617128-189617150 TGCCTGGGCTCCCACTTTGAGGG - Intergenic
986151931 5:5137663-5137685 TGCCTGGGCTCCGACTTTGGCGG + Intergenic
986697927 5:10375036-10375058 TGCCTGGGCTCCCACTTTGGCGG + Intronic
986912463 5:12574427-12574449 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
986912603 5:12574957-12574979 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
986993215 5:13578411-13578433 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
987146322 5:14994288-14994310 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
987156862 5:15097038-15097060 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
987283662 5:16436061-16436083 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
987315225 5:16717828-16717850 TGCCTGGGCTCCCACTTTGGTGG + Intronic
987347498 5:16991421-16991443 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
987352353 5:17032875-17032897 TGCCTGTGCTCCCACTTTGGCGG - Intergenic
987358155 5:17083339-17083361 TGCCTGGGCTCCCACTTTGGCGG + Intronic
987364968 5:17140806-17140828 TGCCTGGGCTCCCACTTTGGTGG + Intronic
987384085 5:17312255-17312277 TGCCTGGACTCCCACTTTGGTGG - Intergenic
987476772 5:18400154-18400176 TGCCTGGACTCCCACTTTGGCGG - Intergenic
987532855 5:19143253-19143275 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
987543759 5:19287622-19287644 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
987633587 5:20509490-20509512 TGCCTCAGCTTGAACCTGGGAGG - Intronic
987876878 5:23691002-23691024 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
987896222 5:23951154-23951176 TGCCTGGGTTCTCACTTTGGCGG + Intergenic
987990312 5:25200505-25200527 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
988073417 5:26324299-26324321 TGCTTGGGCTCCCACTTTGGCGG + Intergenic
988087058 5:26485762-26485784 TGCCTAGGCTCCCACTTTGGCGG - Intergenic
988132089 5:27119775-27119797 TGCCTGGGCTCCCACTTTGGTGG + Intronic
988155129 5:27439933-27439955 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
988369174 5:30345606-30345628 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
988489204 5:31692447-31692469 TGCCTGGGCTCCCACTTTGGCGG - Intronic
988684810 5:33515869-33515891 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
988915969 5:35893351-35893373 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
989003133 5:36782459-36782481 TGCGTGGGCTCCCACTTTGGCGG + Intergenic
989346727 5:40438537-40438559 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
989965760 5:50464892-50464914 TGACTGGGCTCCCACTTTGGTGG + Intergenic
990345192 5:54864955-54864977 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
990461448 5:56035365-56035387 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
990490008 5:56295230-56295252 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
991330294 5:65485914-65485936 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
991567635 5:68020886-68020908 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
992842766 5:80712176-80712198 TCCCTGGACTAGAACCCTGGAGG - Intronic
992947375 5:81823600-81823622 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
993031795 5:82714558-82714580 TGCCTGGGCTCCCACTTTAGTGG + Intergenic
993321005 5:86467164-86467186 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
993328651 5:86570006-86570028 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
993770210 5:91917155-91917177 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
993821959 5:92631207-92631229 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
994096267 5:95851043-95851065 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
994254863 5:97580475-97580497 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
994507033 5:100656641-100656663 TGACTGGGCTCCCACTTTGGCGG + Intergenic
994509911 5:100689349-100689371 TGCCTGGACTCCCACTTTGGCGG - Intergenic
994605678 5:101962930-101962952 TGCTTGGGCTCCCACTTTGGTGG - Intergenic
994701773 5:103142520-103142542 TGCCTGGGCTTCCACTTTGGCGG - Intronic
994928754 5:106154184-106154206 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
994935225 5:106246140-106246162 TGTCTGGGCTCCCACTTTGGCGG + Intergenic
995032250 5:107494125-107494147 TGCCTGGGCTCCCACTTTGGCGG + Intronic
995568603 5:113457022-113457044 TGCCTGGGCTCCCACTTTGGTGG + Intronic
995596524 5:113753600-113753622 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
995656438 5:114432559-114432581 TGCCTGGGCTCCCACTTTGGTGG + Intronic
995679940 5:114704773-114704795 TGCCTAGGCTCCCACTTTGGCGG - Intergenic
995725792 5:115179565-115179587 TGCCTGGGCGCGGAGCGTGGAGG - Intronic
995846484 5:116499388-116499410 TGCCATGGCTTGAACCTGGGCGG + Intronic
995920320 5:117304538-117304560 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
996034863 5:118747374-118747396 TGCCTGGTCTCGAACTTCTGAGG - Intergenic
996106977 5:119516982-119517004 TGCCTGGGCTCCCACTTTGGCGG + Intronic
996234152 5:121107055-121107077 TTCCTGGGCTCCCACTTTGGCGG + Intergenic
996435618 5:123430425-123430447 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
996530321 5:124521500-124521522 TGCCTGGGCTCCCACTTCGGCGG + Intergenic
996815502 5:127569333-127569355 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
997760487 5:136444091-136444113 TGCCTGGGCTCCCACTTCGGTGG + Intergenic
999406107 5:151309065-151309087 TGCCTGGGCTCCCGCTTTGGCGG + Intergenic
999855353 5:155587233-155587255 TGCCTGAGCTCCCACTTTGGCGG - Intergenic
1000065965 5:157693717-157693739 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1000329261 5:160194389-160194411 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1000903608 5:166936702-166936724 TACCTGGGCTCCCACTTTGGCGG - Intergenic
1001083754 5:168685702-168685724 GGCCTGGGGTCGGACCTTGGCGG + Exonic
1002004705 5:176222507-176222529 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1002221672 5:177688113-177688135 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1002333524 5:178461962-178461984 TGCCTGGGCAGGAACTTTCGCGG - Intronic
1002573803 5:180160271-180160293 TGCCTTGACTCGGACCCTGGAGG - Intronic
1002789449 6:426682-426704 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1002907094 6:1457451-1457473 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1003060651 6:2860021-2860043 TGCCTGGGATCCCACTTTGGTGG + Intergenic
1003070156 6:2939504-2939526 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1003081843 6:3027580-3027602 TGCCTGGGCTCCCACTTCGGCGG + Intergenic
1003100123 6:3170644-3170666 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1003170921 6:3721247-3721269 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1003473354 6:6458674-6458696 TTCCTGGGCTCTAACCCTGGAGG - Intergenic
1003577969 6:7315096-7315118 TGCCTGGGCCCCCACTTTGGTGG + Intronic
1003581375 6:7344095-7344117 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1003671467 6:8164215-8164237 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1003717553 6:8665590-8665612 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1003736825 6:8887045-8887067 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1003747937 6:9024156-9024178 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1003770230 6:9290918-9290940 TGCCTGGACTCCCACTTTGGCGG - Intergenic
1003845659 6:10171601-10171623 TGCCTGGGCTCCCACTTTGGAGG + Intronic
1003862724 6:10337288-10337310 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1003908062 6:10720475-10720497 TTCCTGGGCTCCCACTTTGGAGG + Intergenic
1003982541 6:11403064-11403086 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004036885 6:11932903-11932925 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1004053226 6:12108872-12108894 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1004196654 6:13511512-13511534 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004233769 6:13855197-13855219 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004235610 6:13872405-13872427 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004501819 6:16216703-16216725 TGGCTGGGCTCCCACTTTGGCGG + Intergenic
1004503275 6:16227377-16227399 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004519247 6:16346760-16346782 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1004665596 6:17745786-17745808 TGCCTGGACTCCCACTTTGGCGG - Intergenic
1004689162 6:17976670-17976692 TGCCTGAGCTCCCACTTTGGCGG - Intronic
1004906143 6:20238941-20238963 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1004906999 6:20245252-20245274 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1004912566 6:20301140-20301162 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1005035641 6:21552766-21552788 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1005059215 6:21761037-21761059 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1005332952 6:24766418-24766440 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1005596282 6:27381540-27381562 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1005600947 6:27425310-27425332 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1005707518 6:28469835-28469857 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1005725124 6:28640224-28640246 TGCCGGGGCTCCCACTTTGGCGG - Intergenic
1005750002 6:28873075-28873097 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1005758963 6:28950275-28950297 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1005759733 6:28957722-28957744 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1005977077 6:30807924-30807946 TACCTGGGCTCCCACTTTGGCGG - Intergenic
1005978310 6:30816779-30816801 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1006005704 6:31000354-31000376 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1006008237 6:31020599-31020621 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1006033565 6:31195339-31195361 TGCCTGGGCTCCTACTTTGGCGG + Intergenic
1006081859 6:31572428-31572450 TGCCTGGGCCTGGGCCTTGGTGG + Intronic
1006227135 6:32548405-32548427 TTCCTGGGCTCCCACTTTGGTGG - Intergenic
1006352570 6:33532268-33532290 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1006477757 6:34268902-34268924 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1006695938 6:35931145-35931167 TGCCTGGGCTCCCATTTTGGCGG + Intergenic
1006748968 6:36364714-36364736 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1008005662 6:46406248-46406270 TGCCTGGGTTCCCACTTTGGCGG - Intronic
1008038711 6:46774478-46774500 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1008270258 6:49482305-49482327 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1008270558 6:49483899-49483921 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1008284416 6:49630031-49630053 TGCCTAGGCTCCCACTTTGGCGG - Intronic
1008770925 6:54979114-54979136 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1009402754 6:63275412-63275434 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1009407168 6:63326936-63326958 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1009470210 6:64023654-64023676 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1010066227 6:71686043-71686065 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1010199386 6:73269355-73269377 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1010235721 6:73573018-73573040 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1010617307 6:78029677-78029699 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1011143617 6:84189246-84189268 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1011246454 6:85325857-85325879 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1011601545 6:89064902-89064924 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1011870095 6:91882153-91882175 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1012189408 6:96261427-96261449 TGCCTGGGCTCCTACTTTGGCGG - Intergenic
1012578285 6:100829674-100829696 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1012760573 6:103294885-103294907 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1013025792 6:106269885-106269907 TGCCTGGGCTCCTACTTTGGGGG - Intronic
1013081559 6:106817247-106817269 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1013143642 6:107364728-107364750 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1013410856 6:109881649-109881671 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1013694887 6:112689873-112689895 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1013955417 6:115835082-115835104 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1013960023 6:115888983-115889005 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1014460325 6:121686894-121686916 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1014718495 6:124891851-124891873 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1014788399 6:125644330-125644352 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1015572324 6:134634027-134634049 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1015600274 6:134904609-134904631 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1016067444 6:139698397-139698419 TGCCTGGGCTCCCAATTTGGCGG - Intergenic
1016069959 6:139726831-139726853 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1016217120 6:141618090-141618112 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1016378762 6:143451094-143451116 TTCCTGGGCACGGTCCTTGGAGG + Exonic
1016858985 6:148698526-148698548 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1017298915 6:152834221-152834243 TGCTTGGGCTCCCACTTTGGCGG + Intergenic
1017310116 6:152966411-152966433 TGCCTGGGCTCCCACTGTGGGGG - Intergenic
1017537298 6:155362930-155362952 TGCCTGGACTCCCACTTTGGTGG + Intergenic
1017581292 6:155867237-155867259 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1017839578 6:158210270-158210292 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1017929361 6:158939014-158939036 TCCCTGGGCTCCACCCTTGGGGG + Intergenic
1018064309 6:160114983-160115005 TGCCCGGGCTCCCACTTTGGTGG - Intergenic
1018394002 6:163363168-163363190 TCTCTGGGCTCGAACCTAGTTGG + Intergenic
1018545603 6:164933178-164933200 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1018624720 6:165765768-165765790 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1018696266 6:166393828-166393850 TGCCTAGGCTCCCACTTTGGCGG - Intergenic
1019095449 6:169575661-169575683 TGCCTGGGCTGGAACTTAGAAGG + Intronic
1019944339 7:4314418-4314440 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1019965819 7:4497408-4497430 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1020552344 7:9621928-9621950 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1021324050 7:19245362-19245384 TGCCTGCGCTCCCACTTTGGCGG + Intergenic
1021567321 7:22028558-22028580 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1021567953 7:22032806-22032828 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1021686830 7:23194209-23194231 TACCTGGGCTCCCACTTTGGTGG - Intronic
1022293168 7:29022907-29022929 TGCATGGGCTCCAGCATTGGCGG - Intronic
1022750362 7:33218852-33218874 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1023127876 7:36973622-36973644 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1024335709 7:48203398-48203420 TGCCTGGGCTCCTACTTTGGTGG - Intronic
1024465831 7:49711132-49711154 TGCCTGGGCTCCCACTTTGATGG + Intergenic
1024691202 7:51805713-51805735 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1024825494 7:53385644-53385666 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1024833972 7:53494899-53494921 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1025606934 7:63046282-63046304 TGCCTGGCCTTGACCCTAGGTGG - Intergenic
1025962143 7:66231822-66231844 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1026187164 7:68090897-68090919 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1026202876 7:68230927-68230949 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1026335825 7:69393707-69393729 TGCCTGGGCTCTTATTTTGGTGG + Intergenic
1026596629 7:71738561-71738583 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1027561600 7:79739178-79739200 TGCCTGAGCTCCTACTTTGGCGG + Intergenic
1027564115 7:79768446-79768468 TGCCTGGGCTCCCACTATGGCGG - Intergenic
1027579786 7:79978091-79978113 TGCCTGGGTTCCCACTTTGGCGG - Intergenic
1027665819 7:81042587-81042609 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1027698356 7:81437570-81437592 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1027868024 7:83673196-83673218 TGCGTGGGCTCCCACTTTGGCGG + Intergenic
1028070017 7:86440445-86440467 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1028142433 7:87288602-87288624 TCCCTGGGCTCCCACTTTGGTGG + Intergenic
1028303362 7:89229210-89229232 TGCCTGGGCTTCCACTTTGGCGG - Intronic
1028511295 7:91627875-91627897 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1028558101 7:92143807-92143829 TGCCTGGGCTCCCAATTTGGCGG - Intronic
1028778252 7:94705373-94705395 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1029076087 7:97935808-97935830 TGCCTGGGCTCCCACTTTGTCGG + Intergenic
1029567438 7:101348453-101348475 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1029809694 7:103034685-103034707 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1029832447 7:103275407-103275429 TGCCTGGGCTCCCGCTTTGGTGG - Intergenic
1029988093 7:104940035-104940057 TGCCTGGGCTCCCTCTTTGGCGG + Intergenic
1030367086 7:108657698-108657720 TGCCTGGGCTCCCACTTTGACGG - Intergenic
1030600055 7:111582425-111582447 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1030733410 7:113017219-113017241 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1030780339 7:113593198-113593220 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1030819390 7:114077324-114077346 TGCCTGGGCTCCCACTTTGGGGG - Intergenic
1031292329 7:119951992-119952014 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1032248002 7:130229900-130229922 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1032561680 7:132899089-132899111 TGCCTGGGCTCCCAGTTTGGTGG - Intronic
1033065010 7:138146041-138146063 TGCCTGGGCTCCCACTTCGGTGG + Intergenic
1033664178 7:143424876-143424898 TGCCTGGGTTCCCACTTTGGTGG - Intergenic
1034090972 7:148363695-148363717 TGCCTGGGCTCTCACTTTGGTGG + Intronic
1034097841 7:148426287-148426309 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1034154943 7:148948959-148948981 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1034167823 7:149039179-149039201 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1034632209 7:152539342-152539364 TGTCTGGGCTCCCACTTTGGTGG - Intergenic
1034656116 7:152730758-152730780 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1034967183 7:155398631-155398653 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1035151263 7:156874485-156874507 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1035644689 8:1210150-1210172 AGCCTGGCCTGGAACCTGGGGGG - Intergenic
1035999172 8:4582705-4582727 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1036123897 8:6045500-6045522 TGCCTCGGCTCCCACTTTGGCGG - Intergenic
1036378198 8:8218771-8218793 TGCCTGGGCTCCCACGTTGGTGG + Intergenic
1036402081 8:8418028-8418050 TGCTTGAGCTTGAACCCTGGAGG - Intergenic
1036415623 8:8545274-8545296 TGCCTGGGATGGGAACTTGGGGG - Intergenic
1036441108 8:8781873-8781895 TGCCTGGGCTCCCACTTTAGCGG - Intergenic
1036777994 8:11626723-11626745 TGCCTGGCCTCGACCCTAGGTGG + Intergenic
1036831308 8:12022540-12022562 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1036851375 8:12203846-12203868 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1036872739 8:12446120-12446142 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1036901522 8:12673331-12673353 TGCCTGTGCTCCCACTTTGGCGG + Intergenic
1037810898 8:22086432-22086454 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1037957627 8:23071270-23071292 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1037983455 8:23271996-23272018 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1038173997 8:25164374-25164396 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1038639331 8:29311343-29311365 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1039061231 8:33573781-33573803 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1039069185 8:33634315-33634337 TGCCTGGGCTCCCACTTTGGAGG - Intergenic
1040014384 8:42689371-42689393 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1040323899 8:46331611-46331633 TGCCTGGGTTCTCACTTTGGTGG + Intergenic
1040723057 8:50349796-50349818 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1040954990 8:52970329-52970351 TGCCTGGGCTCCCAATTTGGCGG - Intergenic
1041034727 8:53776381-53776403 TGCCTGGGCTCCTACTTTGGCGG - Intronic
1041914454 8:63125987-63126009 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1041918856 8:63161866-63161888 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1043073418 8:75665947-75665969 TGCTTGGGCTCCCACTTTGGCGG - Intergenic
1043110048 8:76169487-76169509 TGCCTGAGCTCCCACTTTGGCGG + Intergenic
1043130013 8:76448096-76448118 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1043346386 8:79303372-79303394 TGCCTGGGTTCCCACTTTGGTGG + Intergenic
1043435249 8:80231686-80231708 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1043709806 8:83402817-83402839 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1043857083 8:85275940-85275962 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1044088419 8:87971032-87971054 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1044617289 8:94155435-94155457 TGCCTGGGCCCGGACTTTGCTGG - Intronic
1044633554 8:94300816-94300838 TGCCTGGGCCCCCACTTTGGCGG - Intergenic
1044880732 8:96719568-96719590 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1045232398 8:100317268-100317290 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1045429862 8:102103485-102103507 TGCCTGGGTTTGAATCCTGGTGG - Intronic
1045467833 8:102485994-102486016 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1045743407 8:105387772-105387794 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1046149420 8:110203053-110203075 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1046265464 8:111823765-111823787 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1046285110 8:112083417-112083439 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1046288830 8:112132570-112132592 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1046450643 8:114386034-114386056 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1047674728 8:127188060-127188082 TGCCTGGGTTAGAACCCTGCTGG - Intergenic
1047778990 8:128096675-128096697 GGCCTGGGCTCGACCCCTGGAGG - Intergenic
1048319213 8:133385441-133385463 TGCCTGGGCTCCAGGCCTGGAGG + Intergenic
1048655481 8:136530892-136530914 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1048789102 8:138084013-138084035 TGCCTGGGCTTCCACTTTGGCGG + Intergenic
1049500240 8:142959357-142959379 CGCCTGGGCTCCCACTTTGGCGG + Intergenic
1050419447 9:5448189-5448211 TGCCTGGGATCCAAACTTGGGGG - Intergenic
1050920550 9:11196757-11196779 TGTCTGGGCTCCCACTTTGGCGG + Intergenic
1051305162 9:15700524-15700546 TGCCTGGGCTCGAACCTTGGCGG - Intronic
1051383226 9:16480386-16480408 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1051463728 9:17353813-17353835 TACCTGGGCTCCCACTTTGGTGG + Intronic
1051892621 9:21959129-21959151 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1052075382 9:24134964-24134986 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1052313362 9:27092532-27092554 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1052979472 9:34437802-34437824 TGCCTGGGCTCCTACTTTGGTGG + Intronic
1053436023 9:38075249-38075271 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1053547992 9:39042839-39042861 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1053644027 9:40110818-40110840 ACCCTGGGCTCGAACCATGGAGG - Intergenic
1053762126 9:41354662-41354684 ACCCTGGGCTCGAACCATGGAGG + Intergenic
1053812114 9:41862880-41862902 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1054324882 9:63708047-63708069 ACCCTGGGCTCGAACCATGGAGG - Intergenic
1054540721 9:66265782-66265804 ACCCTGGGCTCGAACCATGGAGG + Intergenic
1054618481 9:67324559-67324581 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1055049289 9:71963417-71963439 TGCCTGGGCTCCCACTTTGGCGG + Intronic
1055461524 9:76524172-76524194 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1055651300 9:78409875-78409897 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1055691016 9:78830875-78830897 TGCCTGAGCTCGAAAGTTTGAGG - Intergenic
1056081041 9:83093789-83093811 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1056743677 9:89282309-89282331 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1056771473 9:89480901-89480923 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1057511062 9:95680209-95680231 TGCCTAGGCTCCCACTTTGGTGG + Intergenic
1057543934 9:96002202-96002224 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1057628714 9:96701401-96701423 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1058174941 9:101724591-101724613 TGCCTGGGATCCCACTTTGGCGG - Intronic
1058585434 9:106501774-106501796 TGCCTGGGCTCTCACTTTGGTGG - Intergenic
1058727448 9:107817671-107817693 TACCTGGGCTCCCACTTTGGCGG + Intergenic
1058786426 9:108393383-108393405 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1058799303 9:108530023-108530045 TGCCTGGGCTCCCACTTTGACGG + Intergenic
1059791225 9:117643210-117643232 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1059810544 9:117851904-117851926 TGCCTGAGCTCCCACTTTGGCGG + Intergenic
1060594304 9:124839205-124839227 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1061245843 9:129400997-129401019 GGCCTGGGCTCCAACCCTGCGGG + Intergenic
1061483751 9:130909998-130910020 TGCGTGGGCTCCCACTTTGGCGG + Intronic
1061945725 9:133907367-133907389 GGCCTGGGCTTGAACCGTGATGG - Intronic
1062443901 9:136585436-136585458 GGCCTTGGCTGGAACCCTGGGGG - Intergenic
1062544049 9:137053866-137053888 TGCCCGGGCGCGCACCTTGAGGG + Exonic
1203429748 Un_GL000195v1:80259-80281 TGCCTGGGCTCCAACTTTGGCGG + Intergenic
1186295706 X:8145390-8145412 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1187005920 X:15232214-15232236 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1187138971 X:16575331-16575353 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1187304530 X:18083680-18083702 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1187557651 X:20367333-20367355 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1187903940 X:24049569-24049591 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1188167023 X:26874143-26874165 TGCCTGGGCTCACACTTTGGCGG - Intergenic
1188189453 X:27156882-27156904 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1188242493 X:27809016-27809038 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1189209768 X:39275494-39275516 TGCCTGGGTTCCCACTTTGGCGG + Intergenic
1189896909 X:45665251-45665273 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1190905289 X:54721342-54721364 TTCCTTGACTGGAACCTTGGGGG - Intergenic
1192150080 X:68706665-68706687 TGCCAGGGCTCAAGCCTTGGTGG + Intronic
1192186696 X:68952038-68952060 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1192559245 X:72114763-72114785 TCCCTGAGGTGGAACCTTGGCGG + Intergenic
1192870641 X:75180001-75180023 TGCCTGGGCTCCCAGTTTGGCGG - Intergenic
1193040265 X:76997125-76997147 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1193497056 X:82227649-82227671 TGCCTGGGCTAGTACTTAGGTGG + Intergenic
1193709038 X:84857085-84857107 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1193804119 X:85972840-85972862 TGCCTGGGTTCCCACTTTGGCGG - Intronic
1193951844 X:87809152-87809174 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1194121269 X:89966129-89966151 TGTCTGGGCTCCCACTTTGGCGG - Intergenic
1194166267 X:90521213-90521235 TGCCTGGGATCCCACTTTGGCGG + Intergenic
1194650903 X:96512735-96512757 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1195107837 X:101617502-101617524 TGCCTTGGTTGGAACCTTGCAGG - Exonic
1195256246 X:103093991-103094013 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1195259432 X:103117544-103117566 TGCCTAGGCTCCCACTTTGGAGG - Intergenic
1195896438 X:109749802-109749824 TGCCTGGGCTCCCACTTGGGCGG - Intergenic
1196319611 X:114271043-114271065 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1196662593 X:118283188-118283210 TGCCTGGGTTCCCACTTTGGTGG - Intergenic
1196705992 X:118717423-118717445 TGCCTGGGTTCCCACTTTGGCGG - Intergenic
1196714535 X:118798833-118798855 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1196729014 X:118922469-118922491 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1196741447 X:119029391-119029413 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1196762047 X:119208955-119208977 TGCCTGGGATCCCACTTTGGCGG - Intergenic
1196762415 X:119211363-119211385 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1196775128 X:119331751-119331773 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1196775427 X:119333473-119333495 TGCCTGGGCTCCCACTGTGGCGG + Intergenic
1196781538 X:119388068-119388090 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1196794057 X:119488347-119488369 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1196844982 X:119890478-119890500 TGCCTGGGCTCCCACTTCGGCGG + Intergenic
1197000362 X:121432009-121432031 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1197331257 X:125155943-125155965 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1197339972 X:125255524-125255546 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1197344902 X:125319547-125319569 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1198299909 X:135325333-135325355 TGCCTGGGCTCCCACTTTGGTGG + Intronic
1198468053 X:136921308-136921330 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1198664383 X:139004509-139004531 TGCCTGGGCTCCCACTTTGGCGG - Intronic
1198694373 X:139320689-139320711 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1198972666 X:142298729-142298751 GGCCTGGGCTCCCACTTTGGCGG - Intergenic
1199010021 X:142746207-142746229 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1199050305 X:143229174-143229196 TTCCTGGGCTCCCACTTTGGCGG - Intergenic
1199134237 X:144231693-144231715 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1199175464 X:144783510-144783532 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1199356317 X:146867362-146867384 TGTCTGGGCTCCCACTTTGGCGG - Intergenic
1199831369 X:151551675-151551697 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1200423639 Y:2998860-2998882 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1200474126 Y:3623580-3623602 TGTCTGGGCTCCCACTTTGGCGG - Intergenic
1200512538 Y:4098994-4099016 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1200824375 Y:7622700-7622722 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1200888609 Y:8298497-8298519 TGCCTGTGCTCCCACTTTGGCGG + Intergenic
1200942399 Y:8798774-8798796 TGCCTAGGCTTAAAACTTGGCGG - Intergenic
1201285554 Y:12375468-12375490 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1201423117 Y:13820685-13820707 TGCCTGGGCTCCCGCTTTGGCGG - Intergenic
1201479858 Y:14427967-14427989 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1201495763 Y:14590268-14590290 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1201497006 Y:14598681-14598703 TGCCTGGGCTCCCACTTTGGTGG - Intronic
1201572963 Y:15433721-15433743 TGCCTGGTCTCCCACTTTGGTGG + Intergenic
1201715732 Y:17042984-17043006 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1202109766 Y:21407078-21407100 TGCCTGGGCTCCCACTTTGGCGG + Intergenic
1202137177 Y:21677145-21677167 TGCCTGGGCTCCCACTTTGGCGG - Intergenic
1202235680 Y:22708387-22708409 TGCCTGGGCTCCCACTTTGGTGG + Intergenic
1202307479 Y:23487781-23487803 TGCCTGGGCTCCCACTTTGGTGG - Intergenic
1202563322 Y:26182805-26182827 TGCCTGGGCTCCCACTTTGGTGG + Intergenic