ID: 1051306618

View in Genome Browser
Species Human (GRCh38)
Location 9:15717181-15717203
Sequence AGGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051306606_1051306618 21 Left 1051306606 9:15717137-15717159 CCCAGCAGCGGCTATGTGGTGGG No data
Right 1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG No data
1051306602_1051306618 27 Left 1051306602 9:15717131-15717153 CCATGCCCCAGCAGCGGCTATGT No data
Right 1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG No data
1051306608_1051306618 20 Left 1051306608 9:15717138-15717160 CCAGCAGCGGCTATGTGGTGGGG No data
Right 1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG No data
1051306604_1051306618 22 Left 1051306604 9:15717136-15717158 CCCCAGCAGCGGCTATGTGGTGG No data
Right 1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051306618 Original CRISPR AGGGAGAGCACAGTGATTGT GGG Intronic