ID: 1051311661

View in Genome Browser
Species Human (GRCh38)
Location 9:15780655-15780677
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051311658_1051311661 12 Left 1051311658 9:15780620-15780642 CCACATTTCGTGTGTATATATGT 0: 1
1: 0
2: 4
3: 30
4: 280
Right 1051311661 9:15780655-15780677 CTTTATGCACAGTTGTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr