ID: 1051314618

View in Genome Browser
Species Human (GRCh38)
Location 9:15815244-15815266
Sequence AACCCAAAGCAGCTACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051314618 Original CRISPR AACCCAAAGCAGCTACAGAA AGG (reversed) Intronic
901129106 1:6951075-6951097 ACCCCAAATCAGCTATAGAAAGG - Intronic
901183959 1:7360259-7360281 AACCCATAACAGCTACAAAAAGG + Intronic
903256729 1:22107451-22107473 AACCCAAAGCAGCCACTGCCAGG - Intergenic
903795799 1:25928002-25928024 AGCCCAGAGCAGCTACAGAGAGG - Intergenic
905107200 1:35571317-35571339 AACCCAAGGAAGCCACAGACAGG + Intergenic
907689100 1:56645104-56645126 AACCCGAAGCAGCGACAGCGGGG - Intronic
910009573 1:82444458-82444480 AACACAATGCAGCTATAAAAAGG - Intergenic
911359940 1:96863417-96863439 AGACCTAAGCAGCTACAGCATGG - Intergenic
911411655 1:97516900-97516922 CAGCCAAAGCAGTTACTGAATGG + Intronic
911984548 1:104604258-104604280 AACTCATAGTAGCTACATAAAGG + Intergenic
913495774 1:119426872-119426894 AACCCAGAGCTCCTACAAAAGGG - Intergenic
913549980 1:119907741-119907763 AATCCTAAGCAGCTACAGCAAGG - Intergenic
913587910 1:120294147-120294169 AACCCAAACCAGCAGAAGAAAGG - Intergenic
913620275 1:120604222-120604244 AACCCAAACCAGCAGAAGAAAGG + Intergenic
913660304 1:121001219-121001241 AACCACAAGCAGCTTCAGACAGG + Intergenic
914011669 1:143784376-143784398 AACCACAAGCAGCTTCAGACAGG + Intergenic
914166163 1:145176758-145176780 AACCACAAGCAGCTTCAGACAGG - Intergenic
914569926 1:148906011-148906033 AACCCAAACCAGCAGAAGAAAGG - Intronic
914602902 1:149224257-149224279 AACCCAAACCAGCAGAAGAAAGG + Intergenic
914650295 1:149693035-149693057 AACCACAAGCAGCTTCAGACAGG + Intergenic
916397341 1:164405412-164405434 AACTCTAAGAAGCTATAGAAAGG - Intergenic
916604850 1:166330964-166330986 ATCCCAAAGCAGGTCCAGAAAGG + Intergenic
916647002 1:166796652-166796674 AAGACAAAGCTGCTGCAGAATGG + Intergenic
916961617 1:169894706-169894728 TAACCAAAGCAGCTACTGAGTGG - Intergenic
917813910 1:178688201-178688223 AAGCTAAAGCAGAAACAGAAGGG - Intergenic
918416350 1:184311885-184311907 AACCCGCAGCAGCAACAGAGTGG - Intergenic
918818422 1:189222187-189222209 AAAACTAAGCAGCTACAGCAGGG - Intergenic
922933066 1:229404961-229404983 AACCCAAAAGAGCTTCAGATGGG + Intergenic
923264887 1:232304827-232304849 AACCCAAAGCATAAAGAGAAAGG - Intergenic
1062852914 10:759421-759443 AGACCTAAGCAGCTACAGCAAGG + Intergenic
1066259894 10:33719422-33719444 AACCCACAGCTGCTTCAGGATGG - Intergenic
1067451609 10:46385204-46385226 AAGCCAGAGCTGCTAGAGAAAGG + Intronic
1067585630 10:47474552-47474574 AAGCCAGAGCTGCTAGAGAAAGG - Intronic
1068220951 10:54044711-54044733 TTCCCAAAGCAAATACAGAAAGG + Intronic
1068257227 10:54528176-54528198 AACCCAAAGAAATAACAGAAAGG + Intronic
1068648107 10:59492306-59492328 AGACCTAAGCAGCTACAGCATGG + Intergenic
1068884244 10:62082094-62082116 ACCCCAAAGCAGAAACAGTAGGG - Intronic
1069172636 10:65253434-65253456 AGTCCTAAGCAGCTACAGCAAGG + Intergenic
1071231814 10:83596782-83596804 AATACAAAGCAGATACAGAGTGG + Intergenic
1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG + Intergenic
1071513332 10:86281117-86281139 AACCCAAAGCACCTCCATCAGGG + Intronic
1071666503 10:87563957-87563979 AACCATAAGCATCTACAGCAAGG + Intergenic
1072452604 10:95550870-95550892 AACCTAAATCAGCTACTGCATGG - Intronic
1072605577 10:96979391-96979413 AGCACAAAGCAGCTAGTGAAAGG + Intronic
1072638867 10:97196148-97196170 AGCCCAAAGCAGCCACCAAACGG - Intronic
1073261318 10:102192663-102192685 ACCCCTAAGCAGCTGCAGCATGG + Intergenic
1073639077 10:105230838-105230860 AGTCCAAAGCAGCTGCAGCAAGG - Intronic
1074448741 10:113541662-113541684 AATGCAAAGCTGATACAGAAGGG + Intergenic
1074544731 10:114393791-114393813 ACACCAAAGCAGCCTCAGAAGGG + Intronic
1074971057 10:118539184-118539206 AACCCAAAGCAGCTACTGGATGG - Intergenic
1075204200 10:120432531-120432553 AATCCAAATCACATACAGAAGGG - Intergenic
1075672560 10:124272615-124272637 AAACCAGAGCAGATACAGCAAGG + Intergenic
1077793762 11:5469309-5469331 AGCACAAAGCAGCAGCAGAAGGG + Intronic
1077822882 11:5767418-5767440 ACACCATAGCAGCTACTGAATGG + Intronic
1078549821 11:12272303-12272325 AACCCAAAGCTGCTATTGCATGG + Intergenic
1078871297 11:15347678-15347700 AACTCATGGCATCTACAGAATGG - Intergenic
1079149446 11:17884334-17884356 TACCAGAAGCAGCTCCAGAATGG + Intronic
1079524476 11:21368127-21368149 AACACAAAGCAAATAAAGAAGGG - Intronic
1079624161 11:22595864-22595886 CACCCAAAGCAGAGAAAGAAAGG + Intergenic
1079814529 11:25039239-25039261 AACCCCAAGGATCCACAGAAGGG - Intronic
1080317807 11:30970283-30970305 AGTCCTAAGCAGCTACAGCATGG + Intronic
1083388486 11:62330577-62330599 CTCCCAAAGCAGCTACAGGGAGG + Intergenic
1085956545 11:81404201-81404223 TACCCAAAGTAACTAAAGAATGG - Intergenic
1085978598 11:81693782-81693804 AGCCCTAAGCAGCTATAGCAAGG + Intergenic
1086892263 11:92271690-92271712 AAATCAAAATAGCTACAGAAGGG - Intergenic
1088146256 11:106683575-106683597 AACCCAGAATGGCTACAGAAAGG - Intronic
1088159777 11:106855107-106855129 AGACCAAAGCAGCTGCAGCATGG - Intronic
1089090495 11:115870320-115870342 AGCCATAAGCAGCTACAGCAAGG - Intergenic
1089183905 11:116601985-116602007 AATACAAAGCAGCTTCAGACAGG + Intergenic
1090091341 11:123701167-123701189 AACCCCAAGGAGCAACAGTACGG + Intergenic
1092032403 12:5298266-5298288 AACACAAAGCAACAACACAAAGG - Intergenic
1093610735 12:21152353-21152375 AACCAAACTCAGATACAGAAAGG - Intronic
1094531819 12:31283022-31283044 AACCCCAATTAGCTAGAGAAGGG + Intronic
1095655767 12:44667987-44668009 AGACCAAAGCAACTACAGCATGG + Intronic
1095774322 12:45995662-45995684 AACCCAAACCAAATACAGACAGG + Intergenic
1097961646 12:65537243-65537265 AGACCAAAACAGCAACAGAAAGG - Intergenic
1101653553 12:106698935-106698957 AACCCAAAGCAAGCACAAAAAGG - Intronic
1101850748 12:108400086-108400108 ATCTCATTGCAGCTACAGAACGG + Intergenic
1102330850 12:112028993-112029015 AACCCAAGGCAGGTACACAAAGG - Exonic
1103196346 12:119046647-119046669 AACACAAAACAGCAACAGAGAGG - Intronic
1106046031 13:26143077-26143099 AAGGCAAAGCAAATACAGAATGG - Intronic
1107771779 13:43794487-43794509 AATGCAAAGCACCCACAGAATGG - Intergenic
1108308951 13:49166480-49166502 AACCCTAAGCAGCTAGAACAAGG - Intronic
1108988291 13:56622622-56622644 AATCTTAAGCAGCTACAGCAGGG + Intergenic
1109808206 13:67471356-67471378 AATCCTAAGCAGCTACAGCCTGG - Intergenic
1109907448 13:68863995-68864017 AGACCACAGCAGCTACAGCAAGG - Intergenic
1110627823 13:77671185-77671207 AACCCAAACCAGCAGAAGAAAGG + Intergenic
1110739312 13:78976089-78976111 AAGACAAAGTAGATACAGAAAGG - Intergenic
1112478008 13:99749572-99749594 TGCCCAAAGCAGATACACAAGGG - Intronic
1112846312 13:103647597-103647619 AAGCCTAAGCAGCTACAGCAAGG - Intergenic
1113307168 13:109091061-109091083 AACACAAAGCAGGTGCGGAAGGG - Intronic
1116486333 14:45453252-45453274 AGACCTAAGCAGCTACAGAAAGG - Intergenic
1118990672 14:70794328-70794350 AACCCAAAGAAGGTACAGGCAGG + Intronic
1120277565 14:82396723-82396745 AACCCCAGGCAGCCACAGCAGGG + Intergenic
1120657952 14:87218012-87218034 AACCCACAGCCTCTAGAGAAAGG + Intergenic
1121247830 14:92475513-92475535 AAACCAAAGCAGTTACAGAAGGG + Intronic
1122146799 14:99694822-99694844 AACCCAAAGTGAATACAGAAAGG - Intronic
1124097567 15:26662739-26662761 AACCCAAATCAGATCAAGAAAGG + Intronic
1124863998 15:33471454-33471476 ACCCCAAGGCAGCTACTGCAAGG + Intronic
1126825816 15:52546619-52546641 AGCCCTAAGCAGCTGCAGCAAGG - Intergenic
1126996778 15:54453042-54453064 AGCCCTAAGCAGCTACAAAATGG - Intronic
1127057872 15:55150954-55150976 AAACCACAGCAGCTGCAGCAAGG - Intergenic
1127339011 15:58021625-58021647 AGACCTAAGCAGCTACAGCAAGG + Intronic
1127823687 15:62683981-62684003 AACGCAGAGCAGCTGGAGAAAGG - Intronic
1128252017 15:66170470-66170492 AACCCATCGCAGCTACTGAGTGG - Intronic
1129566192 15:76625629-76625651 AGCCCTGAGCAGCTACAGAAAGG - Intronic
1129642613 15:77395544-77395566 ATCCTAAAGCAGCAAGAGAAAGG + Intronic
1129866517 15:78913254-78913276 AACACAAAGAAGGTACAAAATGG - Intergenic
1130624326 15:85498028-85498050 AACCTCAAGGAGCCACAGAATGG + Intronic
1132324527 15:100957609-100957631 AAACCAAAAGAGCTAAAGAATGG - Intronic
1133419157 16:5630934-5630956 ATTCCAAAACAGCTGCAGAATGG + Intergenic
1138195800 16:55051289-55051311 CACCCAAAGCAGCTAATAAATGG - Intergenic
1139368680 16:66450893-66450915 AAGCCACAGCAGCTGCTGAATGG - Intronic
1139368956 16:66453139-66453161 AACCCAAAGCAAGTAGAGGAAGG - Intronic
1141359896 16:83385895-83385917 CACCCAAAGTAGCTTCAGATGGG - Intronic
1143871117 17:9957868-9957890 AACCCAAGCCAGCTCCAGAAGGG + Intronic
1144276936 17:13679355-13679377 AACCCAAAGCAGCAGCTGCAAGG - Intergenic
1144405466 17:14948833-14948855 AACCCAAGATAGCTTCAGAATGG + Intergenic
1146910476 17:36645457-36645479 AGCCCAAAGCAGACACAGAAAGG - Intergenic
1148439648 17:47705147-47705169 AAGGCAAGGCAGCAACAGAAGGG - Intronic
1151856229 17:76724047-76724069 ATCACAAACCACCTACAGAATGG + Exonic
1152213417 17:79017533-79017555 AGCCTGAAGAAGCTACAGAAGGG + Intergenic
1152779774 17:82221619-82221641 ATACCAAAGAAGATACAGAATGG + Intergenic
1157093184 18:44660623-44660645 AACCCAAACTAGTTACTGAAAGG + Intergenic
1158735533 18:60075187-60075209 AAGACCAAGCAGCTACAGCATGG + Intergenic
1160393933 18:78558524-78558546 AAGACGAAGCAGCTACAGGAGGG - Intergenic
1162979649 19:14230389-14230411 AACCCAAACCCCCTTCAGAAGGG + Intergenic
1163375967 19:16930774-16930796 AGCCCTAAGCAGCTACAGCAGGG + Intronic
1166277251 19:41762572-41762594 AACACAAAGAAGTGACAGAAAGG - Intronic
1166736929 19:45091443-45091465 AACTTAAAGGAACTACAGAAAGG - Exonic
928410883 2:31053033-31053055 AACCCTAAGCTGCGGCAGAAGGG + Intronic
928565521 2:32543414-32543436 ATCCAAAAGCAGCCAAAGAATGG - Exonic
929493503 2:42419072-42419094 AACCAAGAGCAGTTACACAAGGG - Intronic
930141738 2:47957587-47957609 AACCCAAAGCAACTACCTCAAGG + Intergenic
930891369 2:56392118-56392140 AACCAATAACAGTTACAGAAAGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933244255 2:79957486-79957508 AAACCAAAGCAGCTGTAGACAGG - Intronic
933771777 2:85749208-85749230 TACTCACAGCAGCTCCAGAAAGG - Intergenic
935729209 2:106051147-106051169 AACCCAAAGCAGAAACCCAATGG - Intergenic
935853511 2:107248985-107249007 ATCCCACAGCAGATCCAGAAAGG - Intergenic
936412561 2:112273719-112273741 TACCCAAATTAGCTACAGAAAGG + Intergenic
937890058 2:126931727-126931749 AGTCCTAAGCAGCTACAGTAAGG - Intergenic
937908357 2:127063635-127063657 AAACCTACGCGGCTACAGAAGGG + Exonic
938717946 2:134038187-134038209 AACCAAAAGCAGGAAAAGAATGG + Intergenic
938822832 2:134976223-134976245 AGTCCTAAGCAGCTACAGCATGG - Intronic
940274821 2:151928376-151928398 AACCAAAAGCAGCCCCATAAAGG + Intronic
940544579 2:155067168-155067190 AACAGAAATCAGCTACAAAAAGG - Intergenic
941696157 2:168553201-168553223 AACCAAAAAGAGCTACAAAATGG + Intronic
941729991 2:168907173-168907195 AATACAAAGCAGCTACTAAATGG - Intronic
941753156 2:169155141-169155163 AACCTAAAGCAGCTACTTAATGG + Intronic
941956533 2:171211277-171211299 AACCCAAACCGGTTATAGAAAGG - Intronic
942487734 2:176456906-176456928 ATCTCAAACCAGCTACATAAAGG + Intergenic
944048490 2:195440007-195440029 AGTCCTAAGCAACTACAGAAAGG + Intergenic
944762651 2:202832908-202832930 AACCCAAAGAAGAGATAGAATGG + Intronic
945866593 2:215182746-215182768 GATCCCAAGCAGCTACAGCATGG - Intergenic
946283033 2:218680138-218680160 TAGCCAAAGCAAATACAGAATGG + Intronic
946693888 2:222333162-222333184 AATCCTAAGCAGCTACAGGAAGG + Intergenic
947557790 2:231112295-231112317 CCCCAAAAGCAGCTACAGAAAGG - Intronic
947866904 2:233404444-233404466 AAACCAAAGCAGCTCCTGAAGGG - Intronic
1169070060 20:2720436-2720458 AACCCAAGTCATCTAAAGAAAGG - Intronic
1170509818 20:17065088-17065110 CACCCACAGCAGCTGGAGAATGG - Intergenic
1170810417 20:19669914-19669936 AACCCAGATCAGCTACAGAATGG + Intronic
1173428746 20:42967166-42967188 AACCCACTGCAGCTACCAAAGGG - Intronic
1175762173 20:61568692-61568714 AACCCAAAGGAGGCACAGGATGG - Intronic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1178394285 21:32227174-32227196 AACCCAAAGCAGAAAAAGGAAGG + Intergenic
1178679346 21:34659643-34659665 AGTCCTAAACAGCTACAGAAAGG + Intergenic
1179190929 21:39121222-39121244 CACCCTAGGCAGCTACAGCAGGG + Intergenic
1179353823 21:40640123-40640145 ACCTCAAAGCAGCTGCAGAGAGG + Intronic
1182512028 22:30826556-30826578 AACCCAGTCCTGCTACAGAAGGG - Intronic
1183678429 22:39312770-39312792 AACCCAGCGAAGCTACAGAAAGG + Intergenic
1183773670 22:39948316-39948338 ACCCCAAAGCAGTGACAGACAGG - Intronic
1183844781 22:40533133-40533155 AACCAAAAGATGGTACAGAAAGG + Intronic
1184564128 22:45281552-45281574 AACCCAAAGTTGCTTCACAATGG - Intergenic
1184564412 22:45283612-45283634 AACCCAAAGTTGCTTCGGAATGG + Intergenic
1184824554 22:46939835-46939857 AACCCAAAGCAGTGACAAGAGGG + Intronic
1185053180 22:48564297-48564319 AAGCCAGAGCAGCTACCTAAGGG + Intronic
949384821 3:3489531-3489553 AACCCCTAGCAGCTACAGCAAGG + Intergenic
952017145 3:28971117-28971139 AGACCTAAGCAGCTACAGCAGGG - Intergenic
953573196 3:44089400-44089422 AACCCAAAGCAAGCAAAGAAAGG - Intergenic
953836730 3:46352628-46352650 GACCTAAAGCAGCTAGAGCAGGG - Intergenic
954435865 3:50495672-50495694 AACCCACAGCAGATACTCAAGGG + Intronic
955469806 3:59274667-59274689 TAAACAGAGCAGCTACAGAAGGG - Intergenic
957813317 3:85256752-85256774 CAACCAAAACAGTTACAGAATGG - Intronic
958640157 3:96795109-96795131 AGACCTAAGCAGCTACAGCAAGG - Intergenic
959130010 3:102343075-102343097 AACCTAAAGCATTCACAGAAGGG - Intronic
959202098 3:103260094-103260116 AACCCAAAATATCTACGGAATGG + Intergenic
959627047 3:108464380-108464402 AAAGCAAGGCAGCTTCAGAAAGG - Intronic
961422236 3:126815617-126815639 AACCCACAGGAGCAACAGCAAGG - Intronic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
963853209 3:150227865-150227887 ACCCCAGAGCAGTTACTGAAGGG - Intergenic
963937226 3:151067155-151067177 ACCCCAGAGCAGGTACTGAAGGG - Intergenic
966694662 3:182777702-182777724 AGTCCTAAGCAGCTACAGCATGG - Intergenic
971226400 4:24756464-24756486 AACCCAAAGCATGCAAAGAAAGG - Intergenic
972198692 4:36686102-36686124 GAGCCAAAGCAGCTAGAGTAAGG - Intergenic
972201029 4:36715252-36715274 AAGCCAAAGGAAATACAGAATGG - Intergenic
972852341 4:43066520-43066542 AACATAATGCAACTACAGAAGGG - Intergenic
973890830 4:55365714-55365736 AACAGAAAACAGCTTCAGAAAGG - Intronic
973911173 4:55582214-55582236 ATCCCAATGAAGATACAGAATGG - Exonic
979098523 4:116583773-116583795 AACCCATTGCAGCTGAAGAAAGG - Intergenic
980825081 4:138063333-138063355 AGTCCTAAGAAGCTACAGAAAGG + Intergenic
981027626 4:140092781-140092803 CTCCCAAAACAGCTCCAGAAGGG + Intronic
981090889 4:140730913-140730935 AGCTCAAAGCATCTTCAGAATGG - Intronic
982901193 4:161004388-161004410 AACCAAAAACATCTTCAGAAGGG + Intergenic
983626189 4:169804248-169804270 AAACCATATCAGCTACCGAAAGG - Intergenic
983632930 4:169867914-169867936 GACCCAGAGCAGCTACACAAAGG - Intergenic
984371926 4:178878478-178878500 AAATCATAGCAGCTATAGAATGG + Intergenic
986873696 5:12080949-12080971 AGCCCTAAGCAGCTACAGCAAGG + Intergenic
987349136 5:17006126-17006148 ACCCCCAAGCAGGTTCAGAATGG + Intergenic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
989296498 5:39833342-39833364 AAACCATATCAGGTACAGAAAGG + Intergenic
990400132 5:55429611-55429633 AGTCCTAAGCAGCTACAGCAGGG + Intronic
992009724 5:72514263-72514285 AGCCCAAGGTAGCTTCAGAATGG - Intergenic
992518005 5:77516138-77516160 TACCCAAAACAGATAGAGAAAGG - Intronic
996286702 5:121802759-121802781 AGCCCTAACCAGCTTCAGAAGGG + Intergenic
997671694 5:135679820-135679842 ACACCTAAGCAGCTACAGCAAGG - Intergenic
1000562103 5:162802231-162802253 AACATAAAGCAGATACACAAAGG - Intergenic
1001547732 5:172580843-172580865 AACCCAGTGCAGCCTCAGAAAGG + Intergenic
1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG + Intergenic
1003609145 6:7592674-7592696 AATTCAAACCAGCTACAGGATGG + Intronic
1004582112 6:16964476-16964498 AATCCAAAGCAGCAACATGAAGG - Intergenic
1004795913 6:19084508-19084530 AACCCAAAGTAAATACTGAATGG + Intergenic
1007192764 6:40033569-40033591 AGGCCAAAAAAGCTACAGAAAGG + Intergenic
1009339901 6:62541439-62541461 AGTCCTAAGCAGCTACAGCAAGG + Intergenic
1010158503 6:72823577-72823599 AGCCAATAGCAGCTGCAGAAGGG + Intronic
1010392171 6:75349929-75349951 AACCCAAAGCAGATTTAGCAGGG + Intronic
1010496415 6:76538043-76538065 AAACCCAAGCAGCTACAGCAAGG - Intergenic
1010792216 6:80077879-80077901 AACCCAAAGCAGTTGCTGCAAGG - Intergenic
1012821050 6:104084727-104084749 AAGCCAAAGGAAATACAGAATGG + Intergenic
1016144692 6:140655473-140655495 AACCCATGGCAGAAACAGAAAGG + Intergenic
1016796000 6:148118177-148118199 AACCCAAAGCAGATAAAACATGG - Intergenic
1017613293 6:156214053-156214075 AGCCCTAAGCAGCCACAGCAAGG - Intergenic
1019462916 7:1170822-1170844 AACCCAAAGTAGCACCAGCATGG + Intergenic
1019844884 7:3488422-3488444 AACCAAAAATAGCTAAAGAAGGG - Intronic
1019923224 7:4175773-4175795 AGCCCAAAGCAGCTTCAAGACGG + Exonic
1024782225 7:52864825-52864847 AGTCCTAAGCAGCTACAGCAAGG + Intergenic
1024917814 7:54523709-54523731 AACCCAAACCAGCAGAAGAAAGG - Intergenic
1025157039 7:56616467-56616489 GAGCCAAAACACCTACAGAATGG + Intergenic
1025475273 7:60912066-60912088 AATCCAAAGCAATTACTGAATGG - Intergenic
1025486983 7:61062539-61062561 AATCCAAAGCAATTACTGAATGG + Intergenic
1025556184 7:62311657-62311679 AATCCAAAGCAATTACTGAATGG + Intergenic
1025566968 7:62447535-62447557 AATCCAAAGCAATTACTGAATGG - Intergenic
1025760395 7:64383921-64383943 AAGACAAAACACCTACAGAACGG - Intergenic
1026128547 7:67601037-67601059 ACCCCAAAGGAGGTAGAGAATGG - Intergenic
1027938402 7:84637785-84637807 AGCCCTAAGCAGATACAGCAAGG - Intergenic
1028865261 7:95702837-95702859 AACTCAAAGCAGCAAAAGAAAGG - Intergenic
1032072870 7:128819961-128819983 AATCAAATGCAGGTACAGAATGG - Intronic
1036759041 8:11494301-11494323 AGCCCACAGGAGCTTCAGAAGGG + Exonic
1038705272 8:29887604-29887626 TACCCAACGCACCTACAAAAAGG + Intergenic
1038997945 8:32946071-32946093 AGTCCTAAGCAGCTACAGCAGGG - Intergenic
1039130108 8:34254044-34254066 AATCCAAAGCAAAGACAGAAGGG + Intergenic
1039374103 8:37015919-37015941 AGCCCAGAGAAGCTCCAGAATGG + Intergenic
1040358627 8:46643633-46643655 GAGCAAAAACAGCTACAGAATGG - Intergenic
1040415772 8:47194136-47194158 ACCCCAAGGCAGCTGCAGCACGG - Intergenic
1040442570 8:47459654-47459676 AACCCAAACCAGCAGAAGAAAGG - Intronic
1040696535 8:50006704-50006726 CACCCAAAGCAGCATCAGTAGGG - Intronic
1041150568 8:54928540-54928562 AACCCAAACCAGCAGAAGAAAGG + Intergenic
1041383621 8:57277858-57277880 AAAACAAGGCAGCTCCAGAAAGG - Intergenic
1042548681 8:69973851-69973873 TACCCAAAACAGCTCCAGATTGG - Intergenic
1044038056 8:87331397-87331419 AATACTATGCAGCTACAGAAAGG - Intronic
1044072315 8:87777976-87777998 AGTCCTAAGCAGCTACAGCATGG + Intergenic
1047116264 8:121844682-121844704 AACACAGAGCAGCTACAAAGAGG + Intergenic
1048783735 8:138028860-138028882 AACCCAAATCAGGTACATAGGGG - Intergenic
1048879628 8:138861595-138861617 ACCCCAAAGCAGCAAGAGAGAGG - Intronic
1049872003 8:144987226-144987248 AAACCGAAGGAGATACAGAAAGG - Intergenic
1050380283 9:5020913-5020935 AGTCCTAAGCAGCTACAGCACGG - Intronic
1050380504 9:5023410-5023432 AGTCCTAAGCAGCTACAGCAAGG - Intronic
1050418586 9:5439109-5439131 AGCCCAAAGCAGGGACAGAGTGG + Intergenic
1051201669 9:14633511-14633533 AGCCCTAAGCAGCTCCAGGAAGG + Intronic
1051314618 9:15815244-15815266 AACCCAAAGCAGCTACAGAAAGG - Intronic
1051761699 9:20474059-20474081 AATCAAAAGCAGCTGCAGCAAGG - Intronic
1052199357 9:25758979-25759001 AACCCAGAGTATCTACATAAAGG + Intergenic
1052735538 9:32338626-32338648 GCCCCAAAGCATATACAGAAGGG + Intergenic
1053948401 9:43339854-43339876 AATCCAAAGCAATTACTGAATGG - Intergenic
1055300470 9:74877482-74877504 AATTCTAAGCAGCTACAGCAAGG + Intronic
1056002353 9:82230677-82230699 AGTCCCAAGCAGCTACAGTAAGG + Intergenic
1056043877 9:82696047-82696069 AATCCTAAGCAGCTGCAGCAAGG - Intergenic
1057048955 9:91907592-91907614 CACCCTGAGCAGCTACAGGAAGG + Intronic
1057131212 9:92655838-92655860 CACCCACAGCAGCTGCAGAAGGG + Intronic
1057624835 9:96667852-96667874 AACCAAAAGCAGCTTGAGATGGG + Intergenic
1058543903 9:106040790-106040812 AAGGCAAAGCAAATACAGAATGG - Intergenic
1059312508 9:113398102-113398124 CACCCAAAGCAGAAACAGTATGG - Intronic
1059484211 9:114614492-114614514 AAACAGCAGCAGCTACAGAATGG - Intronic
1060307029 9:122422639-122422661 AACCAAAAGCAGGTACAAAACGG - Intergenic
1203591581 Un_KI270747v1:68053-68075 AATCCAAAGCAATTACTGAATGG - Intergenic
1186220533 X:7344739-7344761 AACCCACAGCGGCTAAAGCAAGG - Intronic
1187812781 X:23198346-23198368 ATCCCAATGAAGATACAGAATGG + Intergenic
1188729571 X:33630537-33630559 AGACCCAAGTAGCTACAGAATGG + Intergenic
1189680939 X:43515112-43515134 AGCCCAAAGCACCTACCGATAGG - Intergenic
1189784166 X:44544231-44544253 AATCCAAAGGAGGTAAAGAAAGG + Intergenic
1192713500 X:73616131-73616153 AGTCCTAAGCAGCTACAGTAAGG - Intronic
1195059265 X:101177944-101177966 AGCCCTAAGCAGCTACAGCAAGG - Intergenic
1195418077 X:104641896-104641918 AGACCTAAGCAGCTACAAAAAGG - Intronic
1196706025 X:118717967-118717989 AATCTAAAGCAACTAGAGAAAGG + Intergenic
1196998954 X:121416635-121416657 AGACCTATGCAGCTACAGAAAGG - Intergenic
1197411801 X:126124701-126124723 AACCTAGAGCAGCTTCAGATTGG - Intergenic
1197904523 X:131410761-131410783 AATCCTAAGCAGCTACAGCAAGG + Intergenic
1198993473 X:142544797-142544819 TACCCAAAGCAGATAAAAAATGG - Intergenic
1199089274 X:143672005-143672027 AGCCCTGAGCAGCTACAGCACGG - Intergenic
1200743078 Y:6876708-6876730 AGCCCAGAGCAGCTACAGCTTGG + Intergenic
1200843483 Y:7807826-7807848 GAGCCAAAACACCTACAGAATGG + Intergenic
1200858287 Y:7962658-7962680 AACCAAAAACACCTACTGAATGG + Intergenic
1200867519 Y:8060702-8060724 GAGCCAAAGCACTTACAGAATGG - Intergenic
1200871683 Y:8106489-8106511 AAGCCAAAGCGAATACAGAATGG + Intergenic
1200900703 Y:8429060-8429082 GAGCCAAAAGAGCTACAGAAAGG + Intergenic
1200905011 Y:8472928-8472950 GAGCCAAAACAGCTACATAATGG - Intergenic
1201354355 Y:13082126-13082148 AGACCTAAGCAGCTACAGCAAGG + Intergenic