ID: 1051326508

View in Genome Browser
Species Human (GRCh38)
Location 9:15977028-15977050
Sequence CAGGAGGACTGGAGGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 670}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051326508 Original CRISPR CAGGAGGACTGGAGGAATGG AGG (reversed) Intronic
900594369 1:3473841-3473863 TAGGAGGACTGGTGGGGTGGGGG - Intronic
900660296 1:3778785-3778807 AAGGAGGAAGGGAGGAAGGGAGG - Exonic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
902139129 1:14337539-14337561 CAGGAACAATGGAGGAAAGGAGG - Intergenic
902278564 1:15357697-15357719 CTGGAGCCCTGGAGGAAAGGGGG + Intronic
902402385 1:16165376-16165398 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
902466493 1:16621797-16621819 TGGGAGGACTGGAGGGGTGGTGG - Intergenic
902513319 1:16977562-16977584 CAGGAGGGCTGGTGGGCTGGAGG - Intronic
902853466 1:19180901-19180923 AAAGAGGAGTGGAGGAAGGGAGG - Intronic
902912987 1:19614843-19614865 CAGGAGGACAGCAGGAGAGGAGG - Intronic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
903687764 1:25144780-25144802 CAGGAGTAAAGGAGGAGTGGGGG + Intergenic
903859757 1:26357475-26357497 CAGGGGGACTGGGGGTGTGGTGG - Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
904348306 1:29888412-29888434 TAGGAGGTCTGGGGGAATAGTGG - Intergenic
904891063 1:33779940-33779962 CAGCAGGAAAGGAGAAATGGAGG + Intronic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
906294719 1:44642524-44642546 CAGGAGGTGCGGAGGCATGGGGG + Intronic
907220574 1:52904600-52904622 AAGGAGGGCTGGAGTCATGGGGG - Intronic
907267411 1:53271376-53271398 CAGGAGCCCAGGAGGAGTGGGGG + Intronic
907570164 1:55476107-55476129 CCAGAGGAGTGGAGGAATGAGGG + Intergenic
908121017 1:60986045-60986067 CAGGATGACATGAGGAATAGGGG - Intronic
908421307 1:63961091-63961113 AAGGAGGAAAGGATGAATGGAGG - Intronic
908459997 1:64339936-64339958 GAGGAGGACAGGAACAATGGTGG - Intergenic
909688423 1:78377090-78377112 CAGGAGGAAGGGAGAAAGGGAGG + Intronic
910407864 1:86909616-86909638 CACGGGGACAGGAGGAGTGGAGG + Intronic
910422415 1:87080701-87080723 CAGGGGGAATGGAGGAGGGGTGG - Intronic
911612997 1:99977549-99977571 AAGGAGGAAGGGAGGAAGGGAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912609119 1:111025258-111025280 CAGGAGGAGTGGGGGAGGGGTGG - Intergenic
913391503 1:118318097-118318119 CAGGAGCTCTGGAGGTGTGGAGG + Intergenic
915318820 1:155044815-155044837 CAGGAAGTCTGGAGGGAGGGCGG + Intronic
915426763 1:155833745-155833767 GAGGAGGAGGGGAGGAAGGGAGG + Intronic
915524827 1:156469093-156469115 CAGGAGGACTGTGGGGATGAGGG + Intronic
915578164 1:156795232-156795254 AAGGAGGAAAGGAGGAAAGGAGG - Intronic
915738813 1:158102340-158102362 CTGGAGGAATGCAGGTATGGAGG + Intergenic
917060856 1:171037227-171037249 AAGGAGGAAGGGAGGAATGACGG + Intronic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
917961743 1:180151071-180151093 AAGAAGGATTGGAGGATTGGAGG + Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
918439808 1:184555703-184555725 GAGGAGGACTGGAGGTGGGGTGG + Intronic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
918518541 1:185389029-185389051 CAGGAAGGCTGCAGGAAGGGAGG + Intergenic
921018658 1:211215719-211215741 AAGAAGGAAGGGAGGAATGGAGG + Intergenic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
921809749 1:219499103-219499125 GAAGAGGAATGGAGGACTGGTGG + Intergenic
922569882 1:226628196-226628218 CAGCAGGACTGGGGGAGTTGGGG - Intergenic
922653324 1:227359506-227359528 CAGAAAGACTGGAAGATTGGTGG - Intergenic
922875023 1:228933840-228933862 CAGGTGGAGTGAGGGAATGGTGG - Intergenic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923232886 1:232005084-232005106 AAGGAGGAAAGGAGGAAGGGAGG - Intronic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
924229105 1:241948568-241948590 CAAGAGGACTAGATGAAAGGTGG + Intergenic
924574634 1:245268721-245268743 AGGGATGACTGGAGGATTGGAGG - Intronic
924671237 1:246128210-246128232 GAGGAGGAGTGCAGGAATTGGGG - Intronic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1063559342 10:7112049-7112071 CAGGTGGACTGGAGGAAATGTGG + Intergenic
1063985034 10:11493400-11493422 TAGGAGAAATGGGGGAATGGAGG - Intronic
1064063361 10:12158808-12158830 GAGGAGGCCTGGAGGCAGGGTGG - Intronic
1064493516 10:15884723-15884745 AGGGAGGAATGGAGGAAGGGAGG - Intergenic
1064493519 10:15884731-15884753 AGGGAGGAAGGGAGGAATGGAGG - Intergenic
1064614453 10:17138038-17138060 CTGGAGGACTGGATCAATGTGGG + Intergenic
1064652105 10:17519664-17519686 AAGGAGGAAGGGAGGGATGGAGG + Intergenic
1064686459 10:17867118-17867140 AAGGAGGAAGGGAGGAAGGGAGG - Intronic
1064778848 10:18810768-18810790 ATGGAGGAATGGAGGAAGGGAGG - Intergenic
1064778851 10:18810776-18810798 ATGGAGGAATGGAGGAATGGAGG - Intergenic
1064778853 10:18810784-18810806 AGGGAGGAATGGAGGAATGGAGG - Intergenic
1064841438 10:19596809-19596831 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1066305894 10:34140608-34140630 TATGAGGAATGGAGGAAGGGTGG + Intronic
1066754850 10:38700809-38700831 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1067377991 10:45745563-45745585 TTGGAGGACTGGAAGAAAGGCGG - Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067885689 10:50086239-50086261 TTGGAGGACTGGAAGAAAGGCGG - Intronic
1068158640 10:53235000-53235022 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1068776321 10:60872146-60872168 GAGGAGAGCTGGATGAATGGGGG + Intronic
1069784289 10:70977875-70977897 CAGGATGACTGCAGGGATGATGG + Intergenic
1069937006 10:71924469-71924491 GAGGAGAACTAGAGGAACGGAGG - Intergenic
1070173416 10:73950234-73950256 AAGGAAGACTGGGGGACTGGGGG + Intergenic
1070357684 10:75656592-75656614 CTGGAGGACAGGAATAATGGGGG - Intronic
1071088511 10:81892340-81892362 GAGGAGCCCTGGAGGAATTGCGG + Intronic
1071219255 10:83444714-83444736 CACGAGGAGTTTAGGAATGGAGG + Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072139136 10:92574223-92574245 CAGGCGGACTGGAGGGACAGGGG + Intergenic
1072303713 10:94086724-94086746 CAGGAGCACTGTTGGAATGATGG + Intronic
1072426426 10:95334460-95334482 CAGGAGGGCAGGAGGAAGGGAGG + Intronic
1072606169 10:96984576-96984598 CAAGAGTACTGAAGGAATGAAGG + Exonic
1072841073 10:98774584-98774606 CATGAAGACTGAAGGAATGGAGG - Intronic
1073111156 10:101063733-101063755 CAGGAAGCCTGCAGGAGTGGAGG - Intronic
1073491716 10:103856841-103856863 CAGGAAGGTTGGAGGAATAGTGG - Intergenic
1073649071 10:105339915-105339937 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1073803727 10:107072180-107072202 CAGGAAGACTGCAGGGTTGGAGG - Intronic
1073819322 10:107242400-107242422 CAGGAAGACTAAAGGAAGGGAGG - Intergenic
1073819747 10:107247989-107248011 CAAAAGGATTGGAGGATTGGAGG - Intergenic
1073857361 10:107693187-107693209 AAAGAGGCCAGGAGGAATGGAGG - Intergenic
1074086297 10:110210638-110210660 CAGGAGGAGGGGAGGAGAGGGGG - Intronic
1074195420 10:111180316-111180338 AAGGAGGAAAGGAGGAAGGGAGG - Intergenic
1074310387 10:112317429-112317451 AGGGAGGAAGGGAGGAATGGAGG + Intergenic
1074310390 10:112317437-112317459 AGGGAGGAATGGAGGAAGGGAGG + Intergenic
1074326471 10:112455575-112455597 AAGGAGGGCGGGAGGAAGGGAGG - Intronic
1075715940 10:124555372-124555394 CTGGAGGAAGGGAGGAAGGGAGG + Intronic
1076040852 10:127247330-127247352 AAGAAGGACAGGAGGAATGTGGG - Intronic
1076343370 10:129764917-129764939 CAGGAGGAAGGGAGGAAGGGGGG + Intronic
1076516179 10:131045557-131045579 GAGGAGGAAAGGAGGAAGGGAGG + Intergenic
1076614074 10:131744824-131744846 CAGGAGGACAGGAGCATGGGAGG + Intergenic
1076701775 10:132276963-132276985 AAGGAGGAATGGAGGAGGGGAGG - Intronic
1076803661 10:132844580-132844602 CAGGAGGGCCTGAGGAGTGGTGG + Intronic
1076921455 10:133456634-133456656 GAGGAGGACTGGGAGGATGGCGG + Intergenic
1077082029 11:728539-728561 CCGGGGGCCTGGAGGAGTGGTGG - Intergenic
1077274569 11:1697925-1697947 AAGGAGGACAGGAGGACTGATGG - Intergenic
1077498767 11:2899470-2899492 CAGGCTGACTGGAGGAAGGAAGG - Exonic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1079527891 11:21412933-21412955 CAGGATGACTGCAGAACTGGAGG - Intronic
1080466696 11:32504106-32504128 AAGGAGGAAGGGAGGAAAGGAGG + Intergenic
1080769923 11:35331177-35331199 CAGGAGGAAGTGAGGAAGGGAGG - Intronic
1081859857 11:46326692-46326714 CGTGAGGTCTGGAGGAAGGGTGG + Intergenic
1081861551 11:46335890-46335912 CAGGGGGACTGGGGGACCGGGGG + Intronic
1082801201 11:57416229-57416251 CAGGAGACCTGGAGAAATGGGGG + Intronic
1083326790 11:61877007-61877029 CCGGAGGTCTGGAGGCCTGGTGG + Intronic
1083452010 11:62752588-62752610 CAGCAGGACTGGAGGAGGTGGGG - Exonic
1083878692 11:65537836-65537858 CAGGACGACTGGAGCACCGGGGG + Exonic
1085740465 11:79074350-79074372 CAGAAGGACAGAAGGAATGCTGG + Intronic
1086530323 11:87777477-87777499 CAGGAGGAAGGGAGGGATGGGGG - Intergenic
1087468335 11:98539050-98539072 AGGGAGGAAAGGAGGAATGGAGG + Intergenic
1087859209 11:103132887-103132909 GAGGAGGAGTAGAGGAGTGGAGG + Intronic
1089094236 11:115905442-115905464 CATGATGACTGGGGGAGTGGGGG - Intergenic
1089286545 11:117411283-117411305 CAGCAGGACTGGGGGAATAAGGG - Intronic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1090758229 11:129813907-129813929 CAGGAGGCCTGGGGAAGTGGGGG - Intergenic
1091750947 12:3020912-3020934 AAGGAGGAAAGGAGGAGTGGGGG - Intronic
1091940600 12:4477210-4477232 CAGGATGCCTGGCTGAATGGTGG + Intergenic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1092209785 12:6638778-6638800 CGCCAGGACTGGAGGAATGGAGG + Intronic
1092489239 12:8930383-8930405 AAGGAGGACTGGAGGCATTAAGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092745592 12:11669398-11669420 AAGGAGGAAGGGAGGAAAGGAGG - Intronic
1093619017 12:21265004-21265026 CAGGAGGACATGAGGAGAGGAGG + Exonic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095277197 12:40300601-40300623 CAGGAGGGTAGGAGGAAGGGAGG - Intronic
1095302659 12:40603887-40603909 CAGGATTCCTGGAGGAATTGTGG + Intergenic
1095410048 12:41911606-41911628 GAGGGGTACTGGAGGAAAGGGGG + Intergenic
1096193325 12:49633836-49633858 CAGGAGGAGAGCAAGAATGGAGG - Intronic
1096355728 12:50939075-50939097 CAGGAGGAGTGAAGGTGTGGAGG - Intergenic
1097048051 12:56202365-56202387 CAGGAGAACTGGGGGAAGGAGGG - Exonic
1098329699 12:69340487-69340509 CCAGGGGACTGGAGGAATTGAGG - Intergenic
1098824417 12:75275511-75275533 CAGAATGACTGGAAGAATGTGGG + Intergenic
1099169716 12:79349108-79349130 CAGGAGGAAGGGAGGAAGGTAGG + Intronic
1099664817 12:85614534-85614556 TAGGAGCACAAGAGGAATGGAGG - Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1099899692 12:88692567-88692589 AGGGAGGAATGGAGGAAGGGAGG + Intergenic
1100766808 12:97875240-97875262 CATGCGCACTGGAAGAATGGGGG - Intergenic
1100811397 12:98342377-98342399 AAGGAGGAAGGGAGGAATAGAGG - Intergenic
1101444816 12:104730162-104730184 CAGAACGAGTGAAGGAATGGTGG - Intronic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102673634 12:114641052-114641074 AAGGAGGAAGGGAGGGATGGAGG - Intergenic
1103481451 12:121252760-121252782 AAGGAAAACTGGAGGATTGGAGG - Intronic
1103587971 12:121970320-121970342 CAGGATGACAGGAGGCAGGGAGG - Intronic
1104151835 12:126091378-126091400 AAAGAGGACTGAAGGAATGGAGG + Intergenic
1104747073 12:131217217-131217239 CAGGAGGCCTGGGGGAGGGGAGG + Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1105602227 13:21897645-21897667 CAGGATGAAAGGTGGAATGGGGG - Intergenic
1106658076 13:31768765-31768787 CAGGAGGAGTTGAGGAATGTGGG - Intronic
1106772736 13:32978144-32978166 CAGGAGGGCTGGAGTCCTGGAGG + Intergenic
1107020003 13:35741560-35741582 CATGAGGAGTGTAGGAGTGGAGG + Intergenic
1108149397 13:47516943-47516965 ATGCAGGACTGGAGGAGTGGCGG - Intergenic
1108509265 13:51140203-51140225 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1109217795 13:59609879-59609901 CAGGAGGACTGCAGGAAAAAAGG - Intergenic
1110613876 13:77519914-77519936 CAAGAAGGCTGGAGGAATGAAGG + Intergenic
1111460168 13:88529788-88529810 CTGGAGGAATTGAGGAATAGGGG - Intergenic
1111999468 13:95196563-95196585 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1112013063 13:95308188-95308210 CATGTGCACTGGGGGAATGGGGG + Intergenic
1112349758 13:98623006-98623028 CAGGCGGCCCAGAGGAATGGAGG + Intergenic
1112404616 13:99107901-99107923 AAGGAGGAAGGGAGGAAGGGAGG + Intergenic
1112607647 13:100922955-100922977 CAGGACGATTGGAGGATTGTGGG - Intergenic
1112831626 13:103459617-103459639 CAGGAGAAATGGTGGAATTGGGG + Intergenic
1112835748 13:103512195-103512217 GAGGAGGATTGGAGGAAGGAGGG + Intergenic
1113483674 13:110639370-110639392 CTGGAGGACTTGAGGCATGCTGG + Exonic
1114052748 14:18935369-18935391 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1114109810 14:19466557-19466579 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1114484914 14:23056758-23056780 CAGGAGGGGTGGAGGCAGGGAGG + Intronic
1114853113 14:26404391-26404413 GAGGAGGAATGGAGGAAGGATGG + Intergenic
1115034865 14:28845077-28845099 AAGGAGGAAGGGAGGAAAGGAGG - Intergenic
1115147203 14:30239468-30239490 GAGGAGGAAGGGAAGAATGGGGG - Intergenic
1115325332 14:32131503-32131525 CTGGAGGAAGGGAGAAATGGGGG - Intronic
1115462607 14:33678404-33678426 AAGGATGACAGGAGGAAAGGAGG - Intronic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1115725838 14:36215252-36215274 GAGGAGGGCTGGAGGAATCCAGG - Intergenic
1116218934 14:42056770-42056792 AAGGAGGAATGAAGGAATGAAGG + Intergenic
1116972041 14:51076351-51076373 ATGGAGGAATGGAGGAAAGGAGG - Intronic
1116972043 14:51076359-51076381 GAGCAGGAATGGAGGAATGGAGG - Intronic
1117268192 14:54113092-54113114 CAGGAGGAAGAGAGGAAAGGGGG - Intergenic
1117417113 14:55507458-55507480 GGGGAGGACTGGAGGACTAGAGG - Intergenic
1117630569 14:57686491-57686513 CAGGAGGAGTGCAGGAGAGGAGG - Intronic
1118597665 14:67448613-67448635 AAGGAAGCCTGGAGGGATGGTGG + Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119205445 14:72790676-72790698 CAGGGGGACTGACAGAATGGGGG - Intronic
1119336332 14:73836639-73836661 GATGGGAACTGGAGGAATGGTGG + Intergenic
1119854834 14:77891704-77891726 CAGGAGAACAGCTGGAATGGAGG + Intronic
1120249748 14:82048937-82048959 CCGGAACAGTGGAGGAATGGGGG + Intergenic
1120759026 14:88269907-88269929 CAGGTGACATGGAGGAATGGAGG - Intronic
1120764448 14:88315906-88315928 AAGAAGGACGGGAGGAATGAAGG + Intronic
1120869957 14:89328339-89328361 CAGCAGCCCTGGATGAATGGGGG + Intronic
1120869996 14:89328529-89328551 CAGCAGCCCTGGATGAATGGGGG + Intronic
1120889846 14:89482237-89482259 CAGGAGGCCGGGAAGTATGGAGG - Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121701541 14:95958365-95958387 CAGGAAGACTAGAAGAAGGGAGG - Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122309099 14:100783395-100783417 GAGGAGGACAGGAGGAGTGGGGG + Intergenic
1122448832 14:101787362-101787384 AAGGAGGAAGGGAGGAAGGGAGG + Intronic
1122487217 14:102089264-102089286 CAGGTTCACTGGAGAAATGGGGG - Intronic
1122773949 14:104109005-104109027 AAGGAGTACTGGACAAATGGAGG + Intronic
1124720256 15:32105467-32105489 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124720261 15:32105486-32105508 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1125299258 15:38237204-38237226 CAGGAGGACTGCTTGAATGCGGG - Intergenic
1125599362 15:40906962-40906984 CAGTAGGGCTGGGGGAGTGGAGG - Intergenic
1125720446 15:41842651-41842673 GAGGAGGCCTGGAGGAGTGAGGG + Intronic
1126096156 15:45092167-45092189 CAGGAAGGCTGGAGGACTGCAGG + Intergenic
1126173470 15:45713364-45713386 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1126173473 15:45713372-45713394 AAGGAGGAAAGGAGGAAGGGAGG - Intergenic
1127272382 15:57413254-57413276 AAGGAGGGAAGGAGGAATGGAGG - Intronic
1127817538 15:62625037-62625059 CAGGATGACTGGAGGATTCAGGG + Intronic
1128101772 15:65007059-65007081 CATGAGCACTGGAAGAATGGGGG + Intronic
1128324010 15:66711808-66711830 CTGGAGGGCTGGAGGGCTGGAGG + Intronic
1129039254 15:72671275-72671297 CGGGAGTGCTGGAGGAATGGTGG + Intergenic
1129136316 15:73555391-73555413 CAGGAGGTCTGGAGGCATGAAGG - Intronic
1129457386 15:75683113-75683135 CAGCAGGACTGGAGCCCTGGTGG - Intronic
1129726405 15:77903832-77903854 CAGCAGGACTGGAGCCCTGGTGG + Intergenic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130680557 15:85992557-85992579 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1130847145 15:87758137-87758159 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
1131054640 15:89368276-89368298 GAGGAGGACTGGGGGAAAGCTGG - Intergenic
1131152216 15:90054267-90054289 CCGAAGGAGGGGAGGAATGGAGG + Intronic
1131413527 15:92231641-92231663 CAGGAAAACTGGATGAAGGGAGG - Intergenic
1131668758 15:94597559-94597581 TAGGAGGACTTCAGGATTGGTGG + Intergenic
1131719660 15:95154078-95154100 CTGGAGGACTGAACAAATGGGGG + Intergenic
1131908135 15:97166234-97166256 GGGGAGGAAGGGAGGAATGGAGG - Intergenic
1132500228 16:281731-281753 CAGGAGGACTGGGGGTGGGGAGG - Exonic
1132574789 16:659385-659407 CAGGGGTCCTGGAGGAGTGGGGG + Intronic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1133412396 16:5579537-5579559 CAGGTGGACTAGAGGATTGGGGG - Intergenic
1134649877 16:15899901-15899923 CAGGAGCACAGCAGGAATGTAGG + Intergenic
1134902972 16:17955201-17955223 CTGGAGCATTGGAGGAATTGAGG + Intergenic
1135413192 16:22250423-22250445 CAGCTGGGGTGGAGGAATGGGGG + Intronic
1135492297 16:22920044-22920066 CAGGAGTATTGGAGCAGTGGTGG - Intergenic
1135719297 16:24801426-24801448 CTGGAGGACTGGTGGACTGAGGG + Intronic
1135975971 16:27109264-27109286 CAGGAGGGAGGGAGGAAGGGAGG + Intergenic
1136250149 16:28999065-28999087 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1136294172 16:29292201-29292223 CAGCAGTACTGGAGCTATGGGGG + Intergenic
1136489537 16:30597623-30597645 CAGGAAGACTAGAAGAATGCGGG + Intergenic
1136727836 16:32376029-32376051 CAAGAGAAGTGGAGGCATGGTGG + Intergenic
1137321337 16:47386437-47386459 CAGGAGGAGATGAGAAATGGTGG - Intronic
1137466410 16:48713872-48713894 CAGGAGGAAGGGAGGCAGGGAGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138067916 16:53961070-53961092 CAGGTGAACTGGAGCAATGTAGG - Intronic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1139300598 16:65942267-65942289 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
1139300601 16:65942275-65942297 AAGGAGGAAAGGAGGAAGGGAGG + Intergenic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1139961040 16:70717348-70717370 GAGGAGGACTTGAGGACAGGAGG + Intronic
1140185396 16:72765152-72765174 GATGAGGACTGGAGAAGTGGAGG - Intergenic
1140209391 16:72958886-72958908 CAGGGGGACTGAGGTAATGGGGG + Exonic
1141220672 16:82066587-82066609 TAGGAGGACAGGCAGAATGGAGG - Intronic
1141805550 16:86339052-86339074 CTGGAGGCCTGGAAGACTGGGGG - Intergenic
1141812323 16:86383738-86383760 AAGGAGGAAGGGAGGAAGGGAGG + Intergenic
1141833402 16:86522392-86522414 CAGGAGGACAGGAAGAGGGGAGG + Intergenic
1142438591 16:90078520-90078542 CAGGAGGACTTGCAGAACGGAGG + Intronic
1202998599 16_KI270728v1_random:141725-141747 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1203130196 16_KI270728v1_random:1678129-1678151 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1142604634 17:1074673-1074695 CAGGAAGGCTGGAGGCAGGGAGG + Intronic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1142922977 17:3207412-3207434 CAGGAGGACGGATGGACTGGAGG - Intergenic
1143410244 17:6704246-6704268 CAGGAGGGAGAGAGGAATGGAGG - Intronic
1144185194 17:12789967-12789989 AAGGAGGACTGGAGGCTGGGCGG - Intronic
1144201181 17:12943906-12943928 AAGGATGACAGGAGGACTGGAGG - Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146323996 17:31869815-31869837 AAGGAGGGTAGGAGGAATGGAGG - Intronic
1146457992 17:33022007-33022029 AAGGGGCACTGGAGGAATTGTGG - Intronic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147948779 17:44095535-44095557 CAGGAGGCCTCGGGGAAAGGGGG + Intronic
1148699577 17:49579516-49579538 CAGGAGCACTGGAGGAGGAGTGG + Exonic
1148808104 17:50274336-50274358 GAGGAGGAAGGGAGGAAGGGAGG - Intronic
1148859577 17:50596966-50596988 AAGGAGGACAGGAGGAAGAGAGG + Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1150580907 17:66473092-66473114 AAGGAGGAATGGGGGAATGGGGG - Intronic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1150665837 17:67136781-67136803 CAGGAGGGAAGGAGGAATGGGGG + Intronic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151663846 17:75534275-75534297 CAGGAGGAGTCTAGGCATGGCGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151834238 17:76572926-76572948 CTTGAGGTCTGGAGGAGTGGGGG - Intronic
1151885800 17:76922759-76922781 CAGGAAGGTTGGAGGGATGGAGG + Intronic
1152138988 17:78525322-78525344 CAGGAGGCCTTGGGGGATGGAGG - Intronic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152358219 17:79816712-79816734 ATGGAGGCCTGGAGGAATGAAGG - Intergenic
1152688023 17:81704151-81704173 CAGGACAACTGGGGGACTGGTGG - Intronic
1152752502 17:82070351-82070373 CAGGAGGACTGCTTGAATGCAGG - Intergenic
1153953430 18:10076241-10076263 CAGGAGGTCATGAGGAAAGGAGG - Intergenic
1155375088 18:25148494-25148516 AAGCAGGAAGGGAGGAATGGAGG - Intronic
1155461496 18:26089985-26090007 CAGGAGGACTTGGGGAACGCTGG - Intronic
1156088674 18:33440291-33440313 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088678 18:33440299-33440321 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088682 18:33440307-33440329 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088686 18:33440315-33440337 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156958037 18:42992143-42992165 GAGAAGAAGTGGAGGAATGGAGG - Intronic
1157247967 18:46070967-46070989 CAGGTAGAATGGAGGACTGGGGG - Intronic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157552349 18:48590389-48590411 CAGGAGGCCTGTGGGAAAGGGGG + Intronic
1157599496 18:48885411-48885433 CAGGAGGAGAAGAGGCATGGCGG + Intergenic
1159139995 18:64381990-64382012 CAGGAGGAGTTTAGGAGTGGAGG - Intergenic
1160613515 18:80107532-80107554 CGGGAGGTCTGTAGGAAAGGGGG + Intergenic
1160756627 19:760708-760730 CAGGAGGGAGGGAGGGATGGAGG + Intronic
1160764574 19:801737-801759 AGGGAGGACGGGAGGAAGGGAGG - Intronic
1160969724 19:1762240-1762262 CAGGAGGGTTGGAGGGCTGGCGG - Intronic
1160969727 19:1762248-1762270 CAGGAGGGCAGGAGGGTTGGAGG - Intronic
1161329198 19:3678346-3678368 ATGGAGGGATGGAGGAATGGAGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161790673 19:6358013-6358035 CCGGAGGAGTGAAGGAGTGGAGG + Intergenic
1161845257 19:6708508-6708530 AAGGAGGAAAGGAGGAATGGAGG - Intronic
1162172776 19:8804554-8804576 GAGGTGGTCTGGAGGAAAGGTGG - Intergenic
1162555131 19:11381842-11381864 TAGGAGCACTGCAGGCATGGGGG + Exonic
1163061275 19:14763932-14763954 GAGGAGGACAGGAGGAGAGGAGG - Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163238362 19:16043146-16043168 ATGGATGAATGGAGGAATGGAGG + Intergenic
1163633176 19:18427255-18427277 CAGGAGGGCGGGTGGAAAGGTGG - Intronic
1164324516 19:24180039-24180061 GAGGAGGAGAGAAGGAATGGAGG + Intergenic
1164439128 19:28258660-28258682 CAAGAGGAGTGGAGGAGTGAGGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164618630 19:29681039-29681061 CAGGCAGACTGGGGAAATGGTGG - Intergenic
1164770799 19:30807308-30807330 CAGGTGCACTGGAGGAATTATGG + Intergenic
1164931206 19:32177593-32177615 CAGGAGGGAGGGAGGAAGGGAGG + Intergenic
1165343305 19:35227539-35227561 CAGGTGGACTGGGGGAGAGGAGG + Intronic
1165403914 19:35618566-35618588 CAGGAGGGCTGGCGGACTGTGGG + Exonic
1165958647 19:39517084-39517106 CAGGAGGACTGCTTGAATGTAGG - Intronic
1166069591 19:40379344-40379366 CAGAAGGACAGCAGGAAAGGGGG - Exonic
1166119094 19:40674293-40674315 TAGAATGACTGGAGGAAGGGAGG - Intronic
1166320811 19:42017817-42017839 CAGGAGGGCGTGAGGAAAGGAGG + Intronic
1166452857 19:42916701-42916723 CAGGAGTGTTGAAGGAATGGGGG - Intronic
1166455349 19:42935998-42936020 CAGGAGTGTTGAAGGAATGGGGG - Intronic
1166493341 19:43278884-43278906 CAGGAAGACTGCAGGTATGATGG - Intergenic
1166544781 19:43627471-43627493 CAGGAGGACTTGAATAATGCTGG - Intronic
1167200749 19:48063560-48063582 CGGGGGGACGGGAGGGATGGGGG - Intronic
1167644705 19:50699640-50699662 TCGGAGGACTGGAGAATTGGAGG + Intronic
1168642659 19:58040381-58040403 CAGAAGGCCTGGAGAATTGGGGG + Intronic
1168725065 19:58576452-58576474 AAGGAGGAAGGGAGGAAAGGAGG - Intergenic
925060356 2:885750-885772 GAGGAGGACTGGGGGCTTGGAGG + Intergenic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
928602363 2:32915984-32916006 CAGGAGGGAAGGAGGAAGGGAGG - Intergenic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929183665 2:39070440-39070462 TAGAAGGGGTGGAGGAATGGAGG - Intronic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929595098 2:43170710-43170732 CAGGAGGCCTGGTTGCATGGAGG - Intergenic
930771458 2:55134328-55134350 CAAGAGGTCAGGAGGAGTGGGGG - Intergenic
931939994 2:67241513-67241535 AGGGAGGAATGGAGGAAGGGAGG + Intergenic
932050777 2:68395824-68395846 CAGGAGGGGAGGAGGAATGCAGG - Exonic
932576164 2:72963521-72963543 CAGTAGGACAGGGGGAAGGGAGG + Intronic
933862735 2:86486576-86486598 CAGGAGGACTGGAAAAGTAGGGG - Intronic
934318132 2:91945044-91945066 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
935552672 2:104474940-104474962 CAGGTGGACTGTTGGAATGGAGG - Intergenic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936501250 2:113068093-113068115 CAGGAGGAGTGAAGGGATAGAGG - Intronic
936715356 2:115180901-115180923 CAGGAGGAAGGGAGGCATGGAGG - Intronic
937738039 2:125314874-125314896 CAGGTGGAATGGAGAAATTGAGG - Intergenic
938471205 2:131564015-131564037 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
938539473 2:132274334-132274356 CAGGAGGAAAGAAGGAAGGGAGG + Intergenic
938554148 2:132408631-132408653 AAGGAGGAAGGGAGGAAAGGAGG + Intergenic
939067740 2:137504967-137504989 AGGGAGGAAGGGAGGAATGGAGG + Intronic
939549037 2:143590589-143590611 CAGGAGGAATGGATGGTTGGGGG - Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
941638642 2:167962957-167962979 CAGGAGAGCTGGAGGAGTGGGGG + Intronic
942150750 2:173074540-173074562 CTGGATGACTGGAAGAATGATGG - Intergenic
942341961 2:174958161-174958183 CAGGAGGAGAGAAGGAAGGGAGG + Intronic
942504718 2:176629470-176629492 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
942522540 2:176819442-176819464 CTGGAGGAGTGGGGGAATGCAGG - Intergenic
943676970 2:190725183-190725205 TTGGGGGACTGGAAGAATGGTGG - Intergenic
944154549 2:196595613-196595635 GAGGAGGAAGGGAGGAAGGGAGG + Intergenic
944204331 2:197141667-197141689 AAAGAGAAATGGAGGAATGGAGG - Intronic
944292840 2:198027346-198027368 CTGGGGGAATGGAGGAATTGGGG + Intronic
944784497 2:203054495-203054517 CAGGAGGACTGCATGAATCCAGG - Intronic
945984454 2:216342545-216342567 TAGGATGCCTGCAGGAATGGTGG + Intronic
946372846 2:219290957-219290979 GAGGAGGCCTGGAGGCCTGGGGG + Intronic
946523614 2:220493870-220493892 AGGGAGGTCTGGAAGAATGGAGG - Intergenic
946790955 2:223300024-223300046 CTGGAGGACAGAAGGCATGGTGG - Intergenic
946899931 2:224362304-224362326 GAGGAGGAAAGGAGGAAAGGTGG + Intergenic
947645155 2:231733518-231733540 CACATGGACTGGAGGAAGGGTGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947855346 2:233320245-233320267 CAGGATGTCTGGACGAATGAAGG - Intronic
948041588 2:234905698-234905720 AAGGAAGAAGGGAGGAATGGAGG + Intergenic
948515026 2:238498328-238498350 CATGGGGACTGGGGGAAAGGTGG + Intergenic
948581710 2:238991576-238991598 AAGGAAGACAGGTGGAATGGCGG - Intergenic
1168761647 20:353821-353843 TGGGAGGACTTGAGGAATGCTGG - Exonic
1168904938 20:1395484-1395506 AAGGGGGAAAGGAGGAATGGGGG + Intergenic
1169092569 20:2870713-2870735 CAGGAGAGCTGGAGGATGGGGGG - Intronic
1169541623 20:6606096-6606118 AAGGAGGGCGGGAGGAAGGGAGG - Intergenic
1169869739 20:10237898-10237920 CAGGAGAAATGGTGGTATGGGGG - Intronic
1170522190 20:17198306-17198328 CTGGAGGACTGGATGATTGCAGG - Intergenic
1170592766 20:17783505-17783527 CAGGAGGAGTGGAGGTTGGGTGG - Intergenic
1171769603 20:29312231-29312253 AAGAAGGAAGGGAGGAATGGAGG + Intergenic
1172619034 20:36307424-36307446 CCGGAGGGATGGAGGGATGGAGG - Intronic
1173190559 20:40872554-40872576 CAGAAGGACATGAGGAAAGGTGG - Intergenic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173640201 20:44596413-44596435 CATGAAGACTGGAGGTGTGGGGG + Intronic
1174140862 20:48412672-48412694 AAGGAGGAAAGGAGGAAGGGAGG - Intergenic
1174746994 20:53073109-53073131 ATGGAGGAATGGATGAATGGAGG - Intronic
1175384352 20:58584730-58584752 CAGGAGGGAGGGAGGAAGGGAGG - Intergenic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1176195394 20:63834528-63834550 CAGGAGTTCTGGAGGACGGGGGG + Intergenic
1176244153 20:64089461-64089483 TAGGAGGACAGGAAGAAAGGAGG - Intronic
1176292321 21:5052727-5052749 AGGGAGGAATGGATGAATGGAGG - Intergenic
1177593196 21:23200735-23200757 CAGGAGGAAGGGAGGAAGGCAGG + Intergenic
1178142270 21:29698052-29698074 AGGGAGGAATGGAGGAAGGGAGG - Intronic
1178142273 21:29698060-29698082 AGGGAGGAAGGGAGGAATGGAGG - Intronic
1178254962 21:31044030-31044052 CAGGAGGACTGCTGGCATTGAGG - Intergenic
1178953043 21:37000757-37000779 CACGAGGACAGAAAGAATGGTGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179462970 21:41550163-41550185 CAGGAGGACTATTGCAATGGGGG + Intergenic
1179595264 21:42438864-42438886 CAGGAGGTGGGCAGGAATGGAGG + Intronic
1179864939 21:44210931-44210953 AGGGAGGAATGGATGAATGGAGG + Intergenic
1180306310 22:11128728-11128750 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1180471222 22:15657743-15657765 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1180544829 22:16490911-16490933 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1180787933 22:18557342-18557364 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1181109461 22:20592768-20592790 CAGGAGGACTGCTGGAATCCCGG + Intergenic
1181233805 22:21437976-21437998 CAGGAGGCCTGGAGCTATGCTGG - Intronic
1181244845 22:21496867-21496889 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1181436834 22:22916003-22916025 CAGAAGGACTGGATGACTTGGGG - Intergenic
1182075866 22:27495058-27495080 CAGGAGACCTGGAGAAAAGGAGG + Intergenic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1182718178 22:32376677-32376699 CAGGAGGACAGGAGCCATGGTGG - Intronic
1183164486 22:36137237-36137259 CAGCAGGACAGGAGGAATTGAGG + Intergenic
1183170751 22:36186091-36186113 CAGCAGGACATGAGGAATCGAGG + Intergenic
1183782400 22:40007275-40007297 GAGGAGGAGAGGAGGAAAGGAGG - Intronic
1183782495 22:40007707-40007729 GAGGAGGACAGGAGGAAGAGAGG - Intronic
1183989455 22:41588655-41588677 TAGCAGGACTGGAGCAAAGGTGG - Intronic
1184149751 22:42631161-42631183 CAGCAGGAGTGAAGGCATGGAGG - Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184425360 22:44406041-44406063 CAGGAGGCCTGGGAGAATGAAGG - Intergenic
1184900767 22:47445181-47445203 CAGGAGGACAGGAGGATAGGTGG - Intergenic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900807 22:47445358-47445380 CAGGAGGACAGGTGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900847 22:47445563-47445585 CAGGAGGACAGGCGGACAGGTGG - Intergenic
1184900856 22:47445619-47445641 CAGGAGGTCAGGAGGATAGGTGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1184930394 22:47676948-47676970 CAGAAGGTCTGGAGGCTTGGGGG - Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185083690 22:48724349-48724371 GAGGAGGATTGGATGAGTGGGGG + Intronic
949751572 3:7358051-7358073 GAGGAGGAATGGAGCAACGGAGG - Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
950202412 3:11054700-11054722 CAGGAGGCCTGGAGCACTGTGGG + Intergenic
950526866 3:13529356-13529378 AAGGAGGGCAGGAGGGATGGAGG - Intergenic
950825030 3:15809597-15809619 TAGGAGGAATGAAAGAATGGGGG + Intronic
952465308 3:33578542-33578564 CAGGAAGACTGAAAGAAAGGAGG + Intronic
953178543 3:40574768-40574790 CAGGAGGGCTGCAGAAATAGAGG - Intergenic
953691169 3:45120913-45120935 CAGGAGGACTGAAGTGGTGGGGG - Intronic
953842065 3:46397052-46397074 TAGGAGGAAAGGAGGAGTGGGGG + Intergenic
954601733 3:51875592-51875614 CAGGAAGAGTGGAGGAAGGGCGG + Intergenic
956391363 3:68776086-68776108 ACAGAGGAATGGAGGAATGGAGG + Intronic
956683769 3:71805355-71805377 CAGGAGGAAGAGAGAAATGGGGG - Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957521440 3:81323560-81323582 AAGGAGGAAAGGAGGAAGGGAGG + Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958536250 3:95408240-95408262 CAGGATGAATGGGTGAATGGTGG + Intergenic
958835887 3:99144567-99144589 AAGGAGGAAGAGAGGAATGGTGG - Intergenic
960625375 3:119677044-119677066 GAGGAGGAGTGGGGGAAGGGGGG + Intronic
960700570 3:120435394-120435416 GAGGAAGACTGGAAGAAGGGAGG - Intronic
960997059 3:123347329-123347351 CAGGAGGACTGGTGATAAGGTGG + Intronic
961434331 3:126906277-126906299 CTGGAGGCCTGGAGGCCTGGAGG - Intronic
961459112 3:127039095-127039117 GAGGAGGGATGGAGGAATCGAGG + Intergenic
961461411 3:127052570-127052592 CAGGAGGCCTGGAGGAAATGGGG - Intergenic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962374924 3:134851443-134851465 AAGGAGGGATGGAGGAAGGGAGG - Intronic
962425977 3:135269809-135269831 AAGGTGGACTGGAGGGGTGGTGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964731859 3:159876137-159876159 CAGGGAGACTGGAAGAATGGGGG - Intronic
964961545 3:162433974-162433996 GAAGAGGAGTGGAGGAGTGGAGG + Intergenic
965187619 3:165485039-165485061 CTGGAGGAAGGGAGAAATGGGGG + Intergenic
965195812 3:165592576-165592598 GAGGAGGACAGGAGGACGGGAGG - Intergenic
966011105 3:175078584-175078606 CAGGAAAACTGGAGAAATTGGGG - Intronic
966496061 3:180582058-180582080 GGGGAGGAATGGAGGGATGGTGG + Intergenic
966549430 3:181187771-181187793 CAGGAGGACTACAGGAATTTGGG + Intergenic
967411437 3:189170128-189170150 CAGGAGGAGTGGAGACATGCTGG - Intronic
967850360 3:194077762-194077784 TTGGAGGAATGGAGGGATGGAGG + Intergenic
968089802 3:195892896-195892918 CAAGAGGGCGGCAGGAATGGGGG + Intronic
968186122 3:196634543-196634565 CTGGAGAACTGGAGAAGTGGGGG + Intergenic
968628333 4:1637905-1637927 CAGGTGGATGGGAGGAATGGGGG - Intronic
968653231 4:1768051-1768073 CAGGAGGACGGGAGGCGTGCAGG - Intergenic
968952056 4:3700340-3700362 AAGGAGGAGGGGAGGAGTGGAGG + Intergenic
969443615 4:7232139-7232161 GAGCAGGATTGGGGGAATGGAGG + Intronic
969459398 4:7320852-7320874 AGGGAGGAATGGAGGAAGGGAGG - Intronic
969459401 4:7320860-7320882 AGGGAGGAAGGGAGGAATGGAGG - Intronic
969478400 4:7434125-7434147 CAGGAGCTCTGCAGGAAGGGGGG - Exonic
970158482 4:13165527-13165549 GAGGAGGAAAGGAGGAAGGGCGG + Intergenic
970236180 4:13960388-13960410 CTGGAGGACAGAAGGAATGGAGG + Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
970683284 4:18536187-18536209 AGGGAGGAATGGAGGAAGGGAGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
973605074 4:52578646-52578668 CTGGAGGAATGAAGGAAAGGAGG + Intergenic
975497791 4:75053848-75053870 GAGGAGGGCTGGAAGGATGGGGG - Intergenic
976560010 4:86490248-86490270 TAGGAGGAATGAAGGAATGTGGG - Intronic
976615098 4:87068536-87068558 CAGGGAGACGGGAGGTATGGAGG + Intronic
976697029 4:87927724-87927746 AGGGAGGAATGGAGGAAGGGAGG - Intergenic
976725033 4:88207635-88207657 CAGGAGGACTGCTTGAATGCAGG - Intronic
976760732 4:88546492-88546514 AAGGAGGAAGGGAGGAAGGGAGG - Intronic
976898227 4:90138532-90138554 TGAAAGGACTGGAGGAATGGTGG + Intronic
977014323 4:91673659-91673681 AAGGAGGAAAGGAGGAAGGGAGG - Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977536686 4:98261829-98261851 CAGGAAGAATGGAGGAGGGGAGG - Intronic
978032596 4:103953532-103953554 CAGGAAGACTGGAGGCAGAGAGG - Intergenic
978067269 4:104420957-104420979 GAGGAGGAAGGGAGGAAGGGGGG - Intergenic
978236119 4:106462955-106462977 GAGAAGGAGTGGAGGAGTGGGGG + Intergenic
978698651 4:111615740-111615762 CAGGAGGTTTAGAGGAATCGGGG + Intergenic
981453188 4:144922461-144922483 CAGAAGCACTGGAGGATTGGAGG + Intergenic
982687211 4:158505252-158505274 GAGGAGGACAGGAGGAAGAGAGG + Intronic
982833353 4:160090580-160090602 TAAGAGGAGTGGAGAAATGGGGG + Intergenic
982951631 4:161704223-161704245 CAGGAAGACTGGAAGCAGGGAGG - Intronic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983555601 4:169056612-169056634 CAGGATGGCTGGAAGAATAGTGG + Intergenic
983706189 4:170662566-170662588 CACGAGGAATGTAGGAACGGAGG - Intergenic
983938833 4:173521708-173521730 CTGGAGGGCTGGGGGAAGGGAGG + Intergenic
984149396 4:176108000-176108022 CAGGAGGAAGGGAAGAAGGGTGG - Intronic
984930301 4:184841388-184841410 AAAGATGACTGGAAGAATGGCGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985496188 5:207769-207791 CAGGAGGTGTGGAGGGGTGGAGG + Intronic
985553404 5:544412-544434 CAGCAGGACAGGAGGCATCGAGG + Intergenic
985660866 5:1155934-1155956 CGGGAGGCCGGGAGGAAGGGAGG + Intergenic
986009625 5:3700589-3700611 GAGGAGGAGTGGAGGAAGGGGGG - Intergenic
986009687 5:3700934-3700956 GAGGAGGAGTGGAGGAAGAGGGG - Intergenic
986009716 5:3701095-3701117 GAGGAGGAGTGGAGGAAGAGGGG - Intergenic
986409051 5:7458080-7458102 CAGGGATACTGGGGGAATGGTGG + Intronic
986443119 5:7798445-7798467 TAGGAAGAGTGGAGGAGTGGTGG + Intronic
986762142 5:10889877-10889899 CATGAGCACTGAAGGAATGCTGG - Intergenic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
988246444 5:28688729-28688751 GAGGAGGAAGGGAGGAAGGGAGG - Intergenic
988721002 5:33879004-33879026 CCCTAGGAGTGGAGGAATGGGGG + Intronic
990317853 5:54601065-54601087 AGGGAGGACGGGAGGGATGGAGG - Intergenic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
992629870 5:78669561-78669583 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
993809984 5:92464159-92464181 CAGGAGATCTAGAGGAAAGGAGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994792342 5:104245433-104245455 GAGGAAGACTGGAGTAATTGTGG + Intergenic
994945053 5:106377152-106377174 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
995060659 5:107808807-107808829 CAGGAGGATTGGAGAAAAAGTGG - Intergenic
996101839 5:119452492-119452514 CAGGAGGAGGCGGGGAATGGCGG - Intronic
996333508 5:122357585-122357607 CAGGAGGAATGGGAGAAGGGTGG - Intronic
996512208 5:124329266-124329288 CATGTGGAGTGGAGAAATGGAGG - Intergenic
996544821 5:124667236-124667258 TAGGATGGCAGGAGGAATGGTGG + Intronic
996551180 5:124732009-124732031 CAAGAGGATTGTAGGAATTGGGG - Intronic
997464525 5:134078430-134078452 CAGGAGGACAGGAAGACTTGGGG + Intergenic
998080532 5:139271592-139271614 CAAGAGGAGTGCAGGGATGGAGG + Intronic
998351810 5:141506842-141506864 CAGCATGTCTGGAGGACTGGTGG + Intronic
998394333 5:141808750-141808772 CATGAGGCCTGGAGGAAGGATGG + Intergenic
998407893 5:141884134-141884156 TACTAGGAGTGGAGGAATGGGGG - Intergenic
999632855 5:153588349-153588371 GAGGAGTAATGGAGGCATGGGGG - Intronic
999737273 5:154522070-154522092 CAGCAGCACTGGAAGAGTGGGGG - Intergenic
1000989885 5:167900807-167900829 CAGGAAGACTGGAGTGATTGGGG + Intronic
1000993729 5:167937824-167937846 GATGAGGACTGGATGATTGGAGG + Intronic
1001272511 5:170325662-170325684 CAGAAGAAAAGGAGGAATGGAGG + Intergenic
1003538874 6:7000618-7000640 AAGGAGGAAGGGAGGAAGGGAGG + Intergenic
1003714984 6:8636076-8636098 CAGGAGGTCTAGGGGAGTGGTGG + Intergenic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1004239599 6:13908004-13908026 CAGGAGGAAGGTAGGAAGGGAGG - Intergenic
1004702545 6:18092656-18092678 ATGGAGAAATGGAGGAATGGAGG + Intergenic
1004826379 6:19425724-19425746 CAGGAGGAGTTTAGGAGTGGAGG + Intergenic
1006300228 6:33190193-33190215 GGGGAGGGGTGGAGGAATGGGGG + Intronic
1006333942 6:33410932-33410954 GGGGAGGACTGGGGGAAAGGAGG - Intronic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007389995 6:41545583-41545605 CAGGGGGACTGGAGGGATTGTGG - Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007945925 6:45827125-45827147 GAGGAGGAGTGCAGGAAGGGAGG + Intergenic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1012601075 6:101097661-101097683 CAGAAGGACTGGAGTGATAGTGG + Intergenic
1013701740 6:112779373-112779395 CAGAAGGGCAGAAGGAATGGAGG - Intergenic
1014508678 6:122293037-122293059 CAAGAGAACTGCAAGAATGGCGG + Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016869979 6:148807345-148807367 AAGGAGGAATCAAGGAATGGAGG + Intronic
1017922272 6:158882852-158882874 GAGGAGGATTGGAGGATTGAAGG + Intronic
1018030170 6:159835449-159835471 CAAGAGGCCTGGAGGAGAGGAGG + Intergenic
1018216571 6:161533980-161534002 GAGGAGGACAGGTGGAAAGGGGG - Intronic
1018252846 6:161889534-161889556 CAGACAGACTGGAGGGATGGAGG + Intronic
1018388838 6:163327930-163327952 CATGAGGAGTTTAGGAATGGAGG + Intergenic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1018928443 6:168223046-168223068 CAGGAGCTATGGGGGAATGGAGG + Intergenic
1020130371 7:5555894-5555916 CAGGAGGAATGGGGCAAGGGCGG + Intronic
1020387069 7:7618541-7618563 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1021283300 7:18747004-18747026 AATGAGGACTGGAGTTATGGAGG + Intronic
1022519711 7:30998333-30998355 CAGGGGTGCTGGAGGAGTGGAGG - Intergenic
1022992511 7:35722312-35722334 GAGGAGAAGTGGAGGAAAGGAGG + Intergenic
1024095758 7:45981190-45981212 CAGTAGGAATGCAGGCATGGAGG - Intergenic
1024360646 7:48463845-48463867 AAGGAGGAAGGGAGGAAGGGAGG + Intronic
1024360648 7:48463853-48463875 AGGGAGGAAGGGAGGAATGGAGG + Intronic
1024938818 7:54740850-54740872 CAGGAAGACTGGAAGCAGGGAGG - Intergenic
1025003264 7:55335993-55336015 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1025556793 7:62319260-62319282 AAGGAGGAGGGGAGGAAGGGAGG - Intergenic
1025901907 7:65751382-65751404 CGGGAGGACGCGAGGAAGGGTGG - Intergenic
1026917773 7:74132512-74132534 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029490565 7:100867924-100867946 CAGGGGGACCGGAGGATCGGGGG + Exonic
1029607873 7:101609808-101609830 AGGGAGGAATGGAGGAAGGGAGG - Intergenic
1031224755 7:119021650-119021672 CTGGAGGACTGGATTGATGGTGG + Intergenic
1031989270 7:128186411-128186433 AAGGAGGAAGGGAGGAAAGGAGG - Intergenic
1033143991 7:138855257-138855279 CAGGAGGACTGGAAAAGAGGAGG - Intronic
1033597249 7:142866682-142866704 CAGGTGCACAGGAGGAATGAGGG + Intronic
1034121627 7:148633225-148633247 CAGGAGCAATAGAGGAAAGGGGG - Intergenic
1035121096 7:156567681-156567703 CAGGAGTCCTGGTGGAGTGGAGG - Intergenic
1035424256 7:158757076-158757098 CAGTAGCAGTTGAGGAATGGAGG + Intronic
1035776299 8:2191274-2191296 GAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1035776345 8:2191389-2191411 GAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1035776534 8:2191756-2191778 GAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1035776565 8:2191819-2191841 GAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1035851133 8:2920323-2920345 AAGGAAGCCTTGAGGAATGGTGG + Intergenic
1036156563 8:6347548-6347570 CAGGAGGACAGGAGAGATGGAGG - Intergenic
1036644058 8:10601230-10601252 GAGGAGGAGGGGAGGAAGGGAGG + Intergenic
1037216323 8:16456659-16456681 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1037216326 8:16456667-16456689 AAGGAGGAAAGGAGGAAGGGAGG + Intronic
1037623604 8:20588840-20588862 CAGGAGCAATGTAGGAGTGGGGG - Intergenic
1038919638 8:32068526-32068548 CGGAGGGACTGGAGGAGTGGAGG + Intronic
1038957434 8:32482769-32482791 CAGAAGGACTGGAGCTGTGGGGG + Intronic
1039045979 8:33449800-33449822 CAGCATGAATGGAGGCATGGAGG - Intronic
1041143115 8:54843742-54843764 CTGCAGGACTGGAGCAAGGGTGG - Intergenic
1041326085 8:56666127-56666149 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1042050346 8:64697568-64697590 GAGGAGGGCTGAAGGAATGAAGG + Intronic
1043161929 8:76856226-76856248 GAGAAGGACTGGAGGAAGGCCGG - Exonic
1043341869 8:79249560-79249582 CAGCTGGCCTGGTGGAATGGTGG + Intergenic
1044429824 8:92095670-92095692 CAGGAGGGAAGGAGGGATGGAGG + Intronic
1044755043 8:95452731-95452753 CAGGAGGATTGGAGGCTTGCGGG - Intergenic
1045508364 8:102794552-102794574 CAGCTGGAGAGGAGGAATGGTGG - Intergenic
1045731667 8:105248569-105248591 AAGGAGGAAGGGAGGAAGGGAGG + Intronic
1046048863 8:108996816-108996838 CAGTAGCACTGGAGAAATGGTGG - Intergenic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1046727578 8:117691792-117691814 CTGGGGAACTGGAGGAATGGTGG + Intergenic
1047871774 8:129091106-129091128 CAGGCGGACAGGAAGAATCGGGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049222075 8:141432836-141432858 CAGGAGAAATGGGGGCATGGAGG + Intergenic
1049240776 8:141536464-141536486 CAGGCAGCCTGCAGGAATGGGGG - Intergenic
1049280799 8:141743206-141743228 TGGGAGGATTGGAGGATTGGAGG + Intergenic
1049280850 8:141743420-141743442 TTGGAGGATTGGAGGATTGGAGG + Intergenic
1049439068 8:142601004-142601026 AAGGAGGCCTGGAAGAAGGGGGG + Intergenic
1050089799 9:2006180-2006202 AAGGAGGAAGGGAGGAAGGGAGG - Intergenic
1050179210 9:2901641-2901663 CTGAAGGATTGGAGGATTGGTGG - Intergenic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1051952868 9:22658446-22658468 ACGGAGGAAGGGAGGAATGGAGG - Intergenic
1052409689 9:28107018-28107040 GAGGAGGAATTAAGGAATGGGGG - Intronic
1053107690 9:35426212-35426234 CAGGAGGAGAAGAGGAATTGGGG - Intergenic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1055224456 9:73977455-73977477 CGGGAGGAAGGGAGGAAGGGAGG + Intergenic
1055292055 9:74792457-74792479 AAAGAGGACTGGAGGAAGGCAGG - Intronic
1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353914 9:75417971-75417993 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353921 9:75418013-75418035 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353960 9:75418223-75418245 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353967 9:75418265-75418287 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056655967 9:88509460-88509482 CAGGAGTACTCGAGGAATCCAGG + Intergenic
1057243516 9:93434271-93434293 CAGGAGGAAGGGAGGAAGGGTGG - Intergenic
1058369999 9:104255414-104255436 CAGGAAGACTGGAAGTAGGGAGG - Intergenic
1058641347 9:107088702-107088724 CAGCAGGAGAGGAGGTATGGTGG - Intergenic
1058658690 9:107248964-107248986 AAGGAAGATTGGAAGAATGGGGG - Intergenic
1059438670 9:114290632-114290654 CAGGAGGACAGGAGGAGCTGAGG - Intronic
1059548931 9:115208056-115208078 GAGGAGGTATGGAGGTATGGAGG + Intronic
1060594831 9:124841572-124841594 CAGGAGCAAGGGAAGAATGGGGG + Intergenic
1061675646 9:132214190-132214212 CAGGAGGGCGGGTGGAATGTAGG - Intronic
1062181440 9:135193243-135193265 CAGGAGCACTGAAGGGAGGGAGG - Intergenic
1062323799 9:136003238-136003260 CAGGAGGACTCCAGGAAGAGGGG + Intergenic
1062480361 9:136748179-136748201 CTGGAGGGCTGGAGAATTGGAGG - Intronic
1185757728 X:2665205-2665227 TAGGAGGAATGGAGGAAGGAAGG - Intergenic
1185812243 X:3121414-3121436 CAGGAAGACTGGAAGCAGGGAGG + Intergenic
1186489625 X:9961322-9961344 CAGGGTGACTGGTGGAATGTGGG + Intergenic
1186490708 X:9970183-9970205 AAGGAGGAAAGGAGGAAAGGAGG - Intergenic
1186599030 X:11016146-11016168 CAGGAAGAGTGGGGGGATGGTGG + Intergenic
1186903706 X:14087863-14087885 GAGGAGAACTGGAGAAATGAGGG - Intergenic
1187178042 X:16914520-16914542 CAGGAGGACTGCTGGAGTTGAGG + Intergenic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1188150385 X:26667294-26667316 GAGGAGGAAGGGAGGAAGGGTGG - Intergenic
1188537254 X:31211180-31211202 CAGGAGGACGGGAGGACGTGAGG + Intronic
1189223335 X:39391698-39391720 CAGCAGGACTGGAGGCTTGCAGG - Intergenic
1189850105 X:45169342-45169364 CTGGAAGACTGGGAGAATGGTGG - Intronic
1190128297 X:47724680-47724702 AGGGAGGATTGGAGGAATGGAGG - Intergenic
1190746830 X:53328823-53328845 CAGTAGGACTGGGGAAATGCAGG - Intergenic
1191942945 X:66499658-66499680 AAGGAGGAATGCAGGACTGGAGG + Intergenic
1192034488 X:67547096-67547118 CAGGAGGAAAGGAAGAGTGGAGG - Intronic
1192109529 X:68350479-68350501 AAGGAGGAAGGGAGGAAGGGAGG - Intronic
1192183150 X:68928921-68928943 CAGGAAGGCAGGAGGAAAGGAGG + Intergenic
1193684945 X:84566546-84566568 CAAGAAGACTGGTGGAATGATGG + Intergenic
1195658789 X:107358677-107358699 AGGGAGGACTGGAAGACTGGAGG + Intergenic
1198103259 X:133439941-133439963 AAGGAAAACTGGAGGATTGGTGG + Intergenic
1198160558 X:134003695-134003717 CAGAAGGAAGGGAGGAAGGGAGG + Intergenic
1198229165 X:134673258-134673280 AAGGAGGGAGGGAGGAATGGAGG + Intronic
1198449704 X:136754799-136754821 CAGGAGCACAGGAGGAGGGGTGG - Intronic
1199463102 X:148105352-148105374 CAGGAGGAATAGAGCAAAGGGGG - Intergenic
1199924651 X:152450227-152450249 CAAGAGGACTGGGGGAAGGGTGG - Intronic
1200072364 X:153535532-153535554 GAGGAGGCCCGGAGGAAGGGTGG - Intronic
1200222916 X:154400653-154400675 CAGGAGGCCTGGGGCAAAGGTGG - Intronic
1201185690 Y:11400126-11400148 CAAGAGAAGTGGAGGCATGGTGG - Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201458955 Y:14201444-14201466 AAGGAGGGCTGGAGGAGAGGAGG + Intergenic
1201862351 Y:18612796-18612818 CCGGGGGACTGGAGTATTGGAGG + Intergenic
1201870972 Y:18707584-18707606 CCGGGGGACTGGAGTATTGGAGG - Intergenic